The URL can be used to link to this page

050520-CFP911-Halstead1-FP-3 - stamped Submittal Hඉඔඛගඍඉඌ Sඉඔඍඕ Sගඉගඑ඗ඖ —Bඝඑඔඌඑඖඏ 2 72 ඎඔඑඖග ඛගකඍඍග, 67-71 Mඉඛ඗ඖ Sගකඍඍග Sඉඔඍඕ, Mඉඛඛඉඋඐඝඛඍගගඛ 01970 Prepared by: 125 Savannah Ave • Grandy • NC • 27939 Phone (252) 506-2086 • Fax (252) 597-8082 Prepared for: 40 L඗ඟඍඔඔ R඗ඉඌ, Uඖඑග #1 Sඉඔඍඕ, Nඍඟ Hඉඕ඘ඛඐඑකඍ 03079 Pඐ඗ඖඍ: (603) 894-4500 125 Savannah Ave • Grandy • NC • 27939 Phone (252) 506-2086 • Fax (252) 597-8082 This submittal packaged has been designed and prepared by: Earl T. Hall, SET NICET #118619 Fire Alarm Systems, Level IV INTENTIONALLY LEFT BLANK SUBMITTAL INDEX SECTION I EQUIPMENT LIST DEVICE LIST SECTION II MANUFACTURER DATA SHEETS SECTION III BATTERY CALCULATIONS VOLTAGE DROPS SECTION IV QUALIFICATIONS SECTION V SHOP DRAWINGS SECTION I EQUIPMENT LIST DEVICE LIST Qty Manufacturer Part No Description 1SILENT KNIGHT 6808 (SK) FIRE ALARM CONTROL PANEL, ADDRESSABLE, SK PROTOCOL 3SILENT KNIGHT 5496 5496 6A INTELLIGENT REMOTE POWER SUPPLY 1MEIR PRODUCTS BW‐DOCBOX FIRE ALARM DOCUMENT BOX 15"W X 13"H X 4"D RED 8 SYSTEM SENSOR RA100Z REMOTE ANNUNCIATOR LED 2SILENT KNIGHT RTS151KEY REMOTE TEST/RESET STATION, FOR DUCT DETECTOR 1DITEK DTK‐2MHTP 2 PAIR / 4 WIRE SURGE MODULE FOR TELEPHONE DIALERS 4DITEK DTK‐120HW SURGE PROTECTION 56 SILENT KNIGHT SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 5SILENT KNIGHT SK‐PHOTO‐W/B224BI ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR W/ ISOLATOR BASE 2SILENT KNIGHT OSI‐RI‐SK REFLECTIVE BEAM DETECTOR 2 SYSTEM SENSOR BEAM1224 REFLECTOR BEAM REFLECTOR 3SILENT KNIGHT SK‐HEAT ADDRESSABLE HEAT DETECTOR, FIXED TEMP 13 SILENT KNIGHT SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 6SILENT KNIGHT PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX 8SILENT KNIGHT SK‐MINIMON ADDRESSABLE MINI MONITOR MODULE 2SAFETY TECHNOLOGY INT. ABORT SWITCH ‐ GAS CONVENTIONAL ABORT SWITCH FOR GAS CUT‐OFF 6SILENT KNIGHT SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 1SILENT KNIGHT SK‐MONITOR ADDRESSABLE MONITOR MODULE 13 SILENT KNIGHT SK‐RELAY ADDRESSABLE RELAY MODULE 14 SYSTEM SENSOR SRL STROBE, RED 1 EDWARDS 125LEDFR24DB BEACON, FLASHING LED, RED 25 SYSTEM SENSOR P2RL 2‐WIRE, HORN STROBE, RED 12 SYSTEM SENSOR P2RK 2‐WIRE HORN/STROBE OUTDOOR RED Project: 20200409_ES_HALSTEAD‐2 Bill Of Material Report 1 of 2 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 3 SYSTEM SENSOR P2RL‐LF 2‐WIRE, HORN STROBE, RED 51 SYSTEM SENSOR HRL‐LF LF SOUNDER STROBE, WALL, RED 8POWER SONIC PS‐1270 12V, 7AH SEALED LEAD ACID BATTERY TBD GENESIS CABLE #4306 18/2 FPLR FIRE ALARM CABLE TBD GENESIS CABLE #4307 18/4 FPLR FIRE ALARM CABLE TBD GENESIS CABLE #4313 14/2 FPLR FIRE ALARM CABLE 2 of 2 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Model No. Description Location Dist. From Previous L1•D001 SK‐PHOTO‐W/B224BI ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR W/ ISOLATOR BASE PK LVL ENTRY LOBBY 9.9292' L1•D002 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL STAIR‐1 5.2426' L1•D003 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL GAME LOUNGE 21.0850' L1•D004 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL ELEV EQ RM 2.8859' L1•D005 SK‐HEAT ADDRESSABLE HEAT DETECTOR, FIXED TEMP PK LVL ELEV EQ RM 3.0329' L1•D006 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL ELEV LOBBY 6.5057' L1•D007 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL PACKAGE RM 9.9595' L1•D008 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL SPORTS LOUNGE 26.4706' L1•D009 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL SPORTS LOUNGE 25.9687' L1•D010 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL MANAGER'S OFFICE 20.2612' L1•D011 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL BUSINESS LOUNGE 21.9822' L1•D012 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL CORRIDOR 15.1406' L1•D013 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL CORRIDOR 29.8838' L1•D014 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL GAME LOUNGE 56.6116' L1•D015 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL STAIR 2 6.3965' L1•D016 SK‐HEAT ADDRESSABLE HEAT DETECTOR, FIXED TEMP PK LVL STORAGE 8.0824' L1•D017 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL GAS/SPNK/WATER 37.2294' L1•D018 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR PK LVL ELECRIC ROM 38.3328' L1•D019 SK‐PHOTO‐W/B224BI ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR W/ ISOLATOR BASE 1ST FLR ELECRIC ROOM 236.3945' L1•D020 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 13.3996' L1•D021 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 25.0918' L1•D022 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 1ST FLR TRASH ROOM 6.7741' L1•D023 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 67.9925' L1•D024 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 32.2584' L1•D025 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 32.0786' L1•D026 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 32.8266' L1•D027 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 32.7435' Project: 20200409_ES_HALSTEAD‐2 Panel FACP Device Schedule for Circuit L1 Total Distance: 3,548.7687' Wire GA=#18 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 1 of 4 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 L1•D028 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 115 S CORRIDOR 32.6922' L1•D029 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 1ST FLR UTILITY 19.0686' L1•D030 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR ELEV TOP OF SHAFT 4.8311' L1•D031 SK‐PHOTO‐W/B224BI ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR W/ ISOLATOR BASE 2ND FLR ELECTRIC ROOM 371.2288' L1•D032 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 13.3996' L1•D033 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 25.0918' L1•D034 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR TRASH RM 6.7741' L1•D035 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 67.9925' L1•D036 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 32.2584' L1•D037 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 32.0786' L1•D038 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 32.8266' L1•D039 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 215 CORRIDOR 32.7435' L1•D040 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 216 CORRIDOR 32.6922' L1•D041 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR STORAGE 19.0686' L1•D042 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR ELEV LOBBY 4.8311' L1•D043 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR FITNESS AREA 41.1484' L1•D044 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR BUSINESS LOUNGE 28.6390' L1•D045 OSI‐RI‐SK Reflective Beam Detector 2ND FLR BUSINESS LOUNGE 50.2982' L1•D046 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR VESTIBULE CLG 12.4229' L1•D047 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR FITNESS AREA 62.4092' L1•D048 OSI‐RI‐SK Reflective Beam Detector 2ND FLR FITNESS 34.0870' L1•D049 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR FITNESS 8.6031' L1•D050 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 2ND FLR FITNESS 21.5079' L1•D051 SK‐PHOTO‐W/B224BI ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR W/ ISOLATOR BASE 3RD FLR ELEC CLOSET 417.4090' L1•D052 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 13.3996' L1•D053 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 25.0918' L1•D054 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 3RD FLR TRASH RM 6.7741' L1•D055 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 67.9925' L1•D056 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 32.2584' L1•D057 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 32.0786' L1•D058 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 32.8266' L1•D059 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 315 CORRIDOR 32.7435' L1•D060 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 316 CORRIDOR 32.6922' L1•D061 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 3RD FLR STAIR 1 9.4256' 2 of 4 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 L1•D062 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 3RD FLR SRORAGE 17.7899' L1•D063 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR 3RD FLR ELEV LOBBY 4.8311' L1•D064 SK‐HEAT ADDRESSABLE HEAT DETECTOR, FIXED TEMP ELEV TOP OF SHAFT 6.5699' L1•D065 SK‐PHOTO‐W ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR ELEV TOP OF SHAFT 3.3622' L1•D066 SK‐PHOTO‐W/B224BI ADDRESSABLE PHOTOELECTRIC SMOKE DETECTOR W/ ISOLATOR BASE ROOF STAIR 2 224.0896' L1•M001 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 1ST FLR ENTRY LOBBY 13.5968' L1•M002 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 1ST FLR STAIR‐1 7.8907' L1•M003 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 1ST FLR GAME LOUNGE 13.5898' L1•M004 SK‐RELAY ADDRESSABLE RELAY MODULE 1ST FLR ELEV CURTAIN2 20.4503' L1•M005 SK‐RELAY ADDRESSABLE RELAY MODULE 1ST FLR ELEV EQ RM 8.8843' L1•M006 SK‐RELAY ADDRESSABLE RELAY MODULE 1ST FLR ELEV EQ RM 6.8544' L1•M007 SK‐RELAY ADDRESSABLE RELAY MODULE 1ST FLR ELEV CURTAIN 9.0696' L1•M008 PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX PK LVL GARAGE 11.3414' L1•M009 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION PK LVL BUSINESS LOUNGE 50.2909' L1•M010 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION PK LVL CORRIDOR 88.2607' L1•M011 PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX PARKING LEVEL 78.8829' L1•M012 PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX PARKING LEVEL 211.5697' L1•M013 SK‐MONITOR ADDRESSABLE MONITOR MODULE GAS/SPNK/WATER 10.1603' L1•M014 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE GAS/SPNK/WATER 3.6746' L1•M015 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE GAS/SPNK/WATER 0.0000' L1•M016 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE GAS/SPNK/WATER 2.3353' L1•M017 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE GAS/SPNK/WATER 0.0000' L1•M018 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE GAS/SPNK/WATER 2.3353' L1•M019 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE GAS/SPNK/WATER 0.0000' L1•M020 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 1ST FLR STAIR 2 ‐ WF 11.8850' L1•M021 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 1ST FLR STAIR 2 ‐ TAMPER 0.0000' L1•M022 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 115 S CORRIDOR 3.2525' L1•M023 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 116 CORRIDOR 8.4597' L1•M024 SK‐RELAY ADDRESSABLE RELAY MODULE 1ST FLR ELEV CURTAIN 6.4917' L1•M025 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 2ND FLR STAIRS‐2 11.8850' L1•M026 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 2ND FLR STAIRS‐2 0.0000' L1•M027 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 215 CORRIDOR 3.2525' L1•M028 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 216 CORRIDOR 8.4597' L1•M029 SK‐RELAY ADDRESSABLE RELAY MODULE 2ND FLR ELEV CURTAIN 6.4917' 3 of 4 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 L1•M030 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 2ND FLR FITNESS AREA 23.7128' L1•M031 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 2ND FLR FITNESS 21.4151' L1•M032 SK‐RELAY ADDRESSABLE RELAY MODULE 2NF FLR ELE CURTAIN2 7.9845' L1•M033 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 3RD FLR STAIR‐2 11.8850' L1•M034 SK‐MONITOR‐2 ADDRESSABLE DUAL MONITOR MODULE 3RD FLR STAIR‐2 0.0000' L1•M035 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 315 CORRIDOR 3.2525' L1•M036 SK‐PULL‐DA ADDRESSABLE MANUAL PULL STATION, DOUBLE‐ACTION 316 CORRIDOR 8.4597' L1•M037 PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX 3RD FLR LOUNGE 7.4592' L1•M038 Abort Switch ‐ GAS Conventional Abort Switch for Gas Cut‐off 3RD FLR LOUNGE AREA 2.0656' L1•M039 SK‐RELAY ADDRESSABLE RELAY MODULE 3RD FLR FIRE PIT 2 18.8884' L1•M040 SK‐RELAY ADDRESSABLE RELAY MODULE 3RD FLR FIRE PIT 1 9.8568' L1•M041 SK‐RELAY ADDRESSABLE RELAY MODULE 3RD FLR ELEV CURTAIN 6.4917' L1•M042 SK‐RELAY ADDRESSABLE RELAY MODULE TOP OF SHAFT 5.2956' L1•M043 PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX 3RD FLR DECK 7.8379' L1•M044 Abort Switch ‐ GAS Conventional Abort Switch for Gas Cut‐off 3RD FLR GRILL AREA 2.4069' L1•M045 SK‐RELAY ADDRESSABLE RELAY MODULE 3RD FLR GRILL‐2 28.0395' L1•M046 SK‐RELAY ADDRESSABLE RELAY MODULE 3RD FLR GRILL‐1 5.9845' L1•M047 PS‐DATK W/ PS‐WPB CONVENTIONAL DOUBLE ACTION MANUAL PULL STATION, METAL W/ WP BACK BOX ROOF STAIR‐2 7.7807' 4 of 4 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 SECTION II MANUFACTURER DATA SHEETS • Capable of providing up to 198 points to satisfy smaller installation needs • Connect up to 17 panels on one site with convenient single- point access using the SK-NIC Network Interface Card. Connected panels can have mixed compatible FACP models • Convenient field-upgradeable GJSNXBSF •#VJMUJOEVBMQBUI 1054BOE*1 DPNNVOJDBUJPOTXJUI PQUJPOBMDFMMVMBS NPEFMTBWBJMBCMFGPS SFMJBCMFCBDLVQ SFQPSUJOH • 6860 annunciator with a 4 x 40 large display •'PVSVTFS QSPHSBNNBCMFCVUUPOT NJOJNJ[FUJNFTQFOU FYFDVUJOHDPNQMFYPS SPVUJOFUBTLT • Built-in USB interface for convenient and quick programming • Programmable date setting for automatic and convenient Daylight Saving Time changes •+VNQ4UBSUkBVUP QSPHSBNNJOHSFEVDFT JOTUBMMBUJPOUJNF • 125 software zones and 125 output groups for fl exible design options 6808 "EESFTTBCMF'JSF"MBSN$POUSPM1BOFM 5IFJTBOBEESFTTBCMFGJSFBMBSNDPOUSPMQBOFM '"$1 UIBUJTB EJSFDUSFQMBDFNFOUGPSUIF'"$15IFDBOCFDPOGJHVSFEUP BDIJFWFBQPJOUDBQBDJUZPGQPJOUT*UIBTPOFCVJMUJOTJHOBMJOHMJOF DJSDVJU 4-$ XIJDIDBOTVQQPSU4ZTUFN4FOTPSk 4, TFOTPSTBOE 4,NPEVMFTPS)PDIJLJk 4% EFWJDFTQFSMPPQ "DPNNPODPNNVOJDBUJPOTBOEBOOVODJBUJPOMJOLBMMPXTVQUP QBOFMTUPCFDPOOFDUFEWJBDPQQFSPSfiCFSPQUJDDBCMF"EFTJHOBUFE QBOFMJTDPOfiHVSFEBTUIFDPNNVOJDBUPSGPSBMMQBOFMTJOUIFMJOLGPS DPOWFOJFOUTJOHMFQPJOUDPNNVOJDBUJPOT*UBMTPIBTBCVJMUJO EVBM MJOF1054BOE*1DPNNVOJDBUPSXJUIBEEJUJPOBMDFMMVMBSPQUJPOT BWBJMBCMF 5IFTZTUFNDBOCFFOIBODFECZBEEJOHNPEVMFTTVDIBTUIF SFNPUFBOOVODJBUPSXIJDIBMTPIBTGPVSQSPHSBNNBCMFGVODUJPO CVUUPOTUPIFMQBVUPNBUFUBTLTBOESFEVDFUJNFTQFOUBUUIFQBOFM 48*'5kXJSFMFTTDPNQBUJCJMJUZQSPWJEFTPQUJPOTGPSXJSFMFTTEFUFDUJPO UISPVHIB$MBTT"NFTIOFUXPSL*UJTJEFBMGPSIBSEUPXJSFMPDBUJPOT CVJMEJOHTXIFSFOFXXJSJOHJTOPUBMMPXFE PSUPQSPWJEFBOFBTZJOTUBMM fiSFTZTUFNGPSOFXDPOTUSVDUJPOQSPKFDUT48*'5EFWJDFTDBOCF DPNCJOFEXJUIPUIFSIBSEXJSFEDPNQBUJCMFEFWJDFT 5IFBMTPIBTBGPSN$USPVCMFSFMBZ UXPQSPHSBNNBCMFGPSN$ SFMBZT BMPOHXJUIQPXFSGVMGFBUVSFTTVDIBTESJGUDPNQFOTBUJPO QSF USPVCMFNBJOUFOBODFBMFSU BCVJMUJOTFOTPSUFTUUPDPNQMZXJUI/'1" DBMJCSBUJPOUFTUJOHSFRVJSFNFOUT BOEDBMJCSBUJPOUSPVCMFBMFSU '&"563&4#&/&'*54 5IFTVQQPSUTBWBSJFUZPGEFWJDFT JODMVEJOHUIF BOESFNPUFBOOVODJBUPST TFSJBMQBSBMMFMQSJOUFSJOUFSGBDFNPEVMF GPSQSJOUJOH TZTUFNSFQPSUT UIF/"$FYQBOEFS 9- QPXFSNPEVMF BOE4,PS4%EFWJDFT "EESFTTBCMF'JSF"MBSN$POUSPM1BOFMT • General Alarm (Red)'MBTIFTJGJO BMBSNTPMJEXIFOBMBSNJTTJMFODFE • Supervisory (Yellow):'MBTIFTJGB TVQFSWJTPSZDPOEJUJPOFYJTUTTPMJE XIFOTVQFSWJTPSZJTTJMFODFE •System Troubles (Yellow)'MBTIFT JGBUSPVCMFDPOEJUJPOFYJTUT TPMJEXIFOUSPVCMFJTTJMFODFE •System Silenced (Yellow) 0OXIFOBOBMBSN USPVCMFPS TVQFSWJTPSZDPOEJUJPOIBTCFFO TJMFODFECVUOPUZFUDMFBSFE • System Power (Green): 'MBTIFT GPS"$GBJMVSFTPMJEXIFO QPXFSTZTUFNTBSFOPSNBM USER INTERFACE 5IFCVJMUJOYBOOVODJBUPS XJUIDIBSBDUFS-$%EJTQMBZ BOEMBSHFFBTZUPVTFUBDUJMF UPVDIQBEDBOCFVTFEGPSTZTUFN PQFSBUJPO QSPHSBNNJOHBOE NBJOUFOBODF*UIBs fiWF-&%TGPS BMBSN TVQFSWJTPSZ TZTUFNUSPVCMF TZTUFNTJMFODFEBOETZTUFNQPXFS 4ZTUFNPQFSBUJPOTJODMVEFTJMFODJOH BMBSNTBOEUSPVCMFT SFTFUUJOHBMBSNT BOEUIFEJTQMBZPGBMBSNUSPVCMFTBOE NFNPSZ5IFTZTUFNTOPOWPMBUJMF FWFOUIJTUPSZCVGGFSTUPSFT FWFOUTGPSWJFXJOHGSPNUIFCVJMU JOPSSFNPUFBOOVODJBUPS4ZTUFN PQFSBUJPOTDBOCFJOJUJBUFEXJUIB NFDIBOJDBl fiSFfiHIUFSTLFZPSB WBMJEUPEJHJUPQFSBUPSTDPEF •UL-JTUFE4 • CSFM • FDNY$0" •FMBQQSPWFE SIGNAL LINE CIRCUIT (SLC) 5IF4-$MPPQTVQQPSUTNVMUJQMF EFWJDFUZQFT NBJOUFOBODFBMFSUT BOEB CVJMUJOTFOTPSUFTUUPDPNQMZXJUI/'1" DBMJCSBUJPOUFTUJOHSFRVJSFNFOUT INDICATOR LIGHTS PROGRAMMING 5IFTZTUFNPGGFSTTFWFSBMPQUJPOT UPTJNQMJGZBOETQFFEVQQSPHSBNNJOH +VNQ4UBSUkBVUPQSPHSBNNJOH NJOJNJ[FTQSPHSBNNJOHSFRVJSFEUPTUBSU BOFXTZTUFN5IFCVJMUJOLFZQBE PSUIF PSSFNPUF BOOVODJBUPSTHJWFZPVPOTJUFBDDFTTUP DVSSFOUTZTUFNQSPHSBNNJOH 1SPHSBNNJOHDBOBMTPCFBDDPNQMJTIFE VTJOHUIF8JOEPXTkCBTFE)POFZXFMM 'JSF4PGUXBSF4VJUF )'44 QSPHSBN SOFTWARE TOOLS SKST:4JMFOU,OJHIU4FMFDUJPO5PPM QSPWJEFTUIFJOTUBMMFSPSEFTJHOBSDIJUFDU XJUIB8JOEPXTkTPGUXBSFTZTUFN DPOGJHVSBUJPOUPPMUPDSFBUFBEFUBJMFE#JMM PG.BUFSJBM #0. BOECBUUFSZ DBMDVMBUJPOT HFSS:)POFZXFMM'JSF4PGUXBSF4VJUF QSPWJEFTDPNNVOJDBUJPOBOEQBOFM QSPHSBNNJOH EFUFDUPSTUBUVT FWFOU IJTUPSZBOEBEEJUJPOBMEBUB3FRVJSFTB 1$SVOOJOH.JDSPTPGUk8JOEPXTk ADDITIONAL INFORMATION 5XJTUFEVOTIJFMEFEQBJS XJSFJTSFDPNNFOEFE 5IFBMTPIBTQSFTFUOPUJGJDBUJPO DBEFODFQBUUFSOT JODMVEJOH"/4* "(&/$:-*45*/(4"/%"11307"-4 /1'" /'1" /'1" /'1" /'1"$FOUSBMTUBUJPOSFNPUF 4JHOBMJOH-PDBM1SPUFDUJWF4JHOBMJOH 4ZTUFNT"VYJMJBSZ1SPUFDUFE1SFNJTFT 6OJU8BUFS%FMVHFSFMFBTJOHTFSWJDF 4VJUBCMFGPSBVUPNBUJD NBOVBM XBUFSGMPX TQSJOLMFSTVQFSWJTPSZ %"$5 OPODPEFE TJHOBMJOHTFSWJDFT ORDERING INFORMATION "EESFTTBCMF'JSF"MBSN $POUSPM1BOFM 3FEDBCJOFU COMPATIBLE ANNUNCIATORS 6860:Y-$%SFNPUe fiSF BOOVODJBUPS MJOFTBOEVQUP DIBSBDUFST QFSTZTUFNGPVS QSPHSBNNBCMFCVUUPOT 5860:Y-$%SFNPUe fiSF BOOVODJBUPSJTHSBZ3JTSFE 6855:Y-$%SFNPUe fiSF BOOVODJBUPS 5865-3 or 5865-4:-&%BOOVODJBUPST DBOEJTQMBZVQUP-&%T SFEBOE ZFMMPX 5IFIBTLFZTXJUDIFT GPSTJMFODFBOESFTFU BOEBTZTUFN USPVCMF-&% 5880:-&%*0NPEVMFIBT QSPHSBNNBCMF-&%PVUQVUTBOEFJHIU TVQFSWJTFEESZDPOUBDUJOQVUTXIJDIBSF VTFGVMGPSDVTUPNBQQMJDBUJPOT:PVDBO VTFVQUPFJHIUNPEVMFTPOPOF DPOUSPMQBOFMGPSNBYJNVm flFYJCJMJUZ *UTDPNQBDUTJ[FBMMPXTNPVOUJOHJOTJEF UIFBOOVODJBUPS PSJOBOBDDFTTPSZ DBCJOFU 6808 COMPATIBLE DEVICES AND ACCESSORIES 4FFUIFEBUBTIFFUTMJTUFECFMPXGPSB DPNQMFUFMJTUJOHPGUIF4, 4%PS48*'5 EFWJDFT 4,%FWJDFT%BUB4IFFU 4%%FWJDFT%BUB4IFFU 48*'5 XJSFMFTTEFWJDFT 'PSBDPNQMFUFBOEDVSSFOUMJTUJOHPG DPNQBUJCMFEFWJDFTBOEBDDFTTPSJFT WJTJU www.silentknight.com Important::PVDBOOPUNJY4,BOE4% EFWJDFTJOUIFTBNFGJSFBMBSNTZTUFN 1BHFPGŘ# 4,$0.1"5*#-&"%%3&44"#-& DEVICES SK-ACCLIMATE: Multi criteria photoelectric smoke detector with thermal 135°F fixed temperBture SK-BEAM: Reflected beam smoke detector without test feature SK-BEAM-T: Reflected beam smoke detector with test feature SK-CONTROL: Supervised control module SK-CONTROL-6: Six circuit supervised control module SK-DUCT: Photoelectric duct smoke detector with extended air speed range SK-FIRE-CO: Four criteria fire and carbon monoxide detector SK-HEAT: Fixed thermal detector (135°F) 4,)&"58'JYFEUIFSNBMEFUFDUPS m' XIJUF SK-HEAT-ROR: Fixed rate of rise detector (135°F) 4,)&"53038'JYFESBUFPGSJTF EFUFDUPS m' XIJUF SK-HEAT-HT: Fixed high temperature thermal detector (190°F) 4,)&"5)58'JYFEIJHIUFNQFSBUVSF UIFSNBMEFUFDUPS m' XIJUF SK-ISO: Fault isolator module SK-MINIMON: Mini monitor module SK-MONITOR: Monitor module SK-MONITOR-2: Dual input monitor module SK-MON-10: 10 input monitor module SK-PHOTO: Photoelectric smoke detector 4,1)05081IPUPFMFDUSJDTNPLF EFUFDUPS XIJUF SK-PHOTO-T: Photoelectric smoke detector with thermal (135°F fixed temperBture) 4,1)050581IPUPFMFDUSJDTNPLF EFUFDUPSXJUIUIFSNBM m'GJYFE UFNQFSBUVSF XIJUF SK-PHOTOR: Photoelectric detector with remote test capability 4,1)050381IPUPFMFDUSJDEFUFDUPS XJUISFNPUFUFTUDBQBCJMJUZ XIJUF SK-PULL-SA: Addressable single action pull station SK-PULL-DA: Addressable dual action pull station SK-RELAY: Addressable relay module SK-RELAY-6: Addressable Six relay control module SK-RELAYMON-2: Addressable Dual relay/monitor module SK-ZONE: Addressable zone interface module SK-ZONE-6: Six zone interface module # *7 CBTFGPS4,84FSJFT #-1NPVOUJOHCBTF # #- *7 8)*5& GMBOHFMFTTCBTF #'MBOHFMFTTNPVOUJOHCBTF #4 *7 8) *OUFMMJHFOUTPVOEFSCBTF #4*OUFMMJHFOUTPVOEFSCBTF #4-' *7 8) -PX'SFRVFODZ JOUFMMJHFOUTPVOEFSCBTF #4-'-PXGSFRVFODZJOUFMMJHFOU TPVOEFSCBTF #3# *7 8) 3FMBZCBTF #3#3FMBZCBTF ##* *7 8) *TPMBUPSCBTF B224BI: Isolator base SD COMPATIBLE ADDRESSABLE DEVICES SD505-6AB: Addressable 6" base SD505-6IB: Addressable 6" short circuit isolator base SD505-6RB: Addressable 6" relay base SD505-6SB: Addressable 6" sounder base SD500-AIM: Addressable input module (switch input) SD500-ANM: Addressable notification module SD500-ARM: Addressable relay module SD505-DTS-K: Remote test switch and LED indicator for the SD505-DUCTR SD505-DUCT: Addressable Duct Smoke Detector. SD505-DUCTR: Addressable Duct Detector housing with relay base. SD505-HEAT: Absolute temperature heat detector. Trip point range from 135°F–150°F (0°C–37°C). SD500-LIM: Addressable Line isolator module SD500-MIM: Addressable Mini input monitor module (switch input) SD505-PHOTO: Photoelectric smoke detector SD500-PS/-PSDA: Addressable Single or dual action pull station SD500-SDM: Addressable smoke detector module AUDIBLE/VISIBLE DEVICES These AV devices are all 2-wire. Color: “R” indicates red; “W” denotes white. For a complete listing of Silent Knight AV devices go to XXXTJMFOULOJHIUDPN. CHSRL/CHSWL: Wall chime/strobe CHSCRL/CHSCWL: Ceiling chime/strobe CHRL/CHWL: Wall chime HRL/HWL: Wall horn P2RL/P2WL: Wall horn/strobe PC2RL/PC2WL: Ceiling horn/strobe SRL/SWL: Wall strobe SCRL/SCWL: Ceiling strobe SPSCRL/SPSCWL: Ceiling speaker/strobe SPSRL/SPSWL: Wall speaker/strobe SPRL/SPWL: Wall speaker SPCRL/SPCWL: Ceiling speaker SWIFT WIRELESS DEVICES SWIFT is only compatible with System Sensor (SK) devices. It is not compatible with Hochiki (SD) devices. 84,8(*8JSFMFTT(BUFXBZ 84,1)0508JSFMFTT1IPUPFMFDUSJDTNPLF EFUFDUPS WSK-PHOTO-T:8JSFMFTT.VMUJDSJUFSJB QIPUPFMFDUSJDTNPLFEFUFDUPSXJUIUIFSNBM EFUFDUJPO m'GJYFEUFNQFSBUVSF BOE #8CBTF WSK-HEAT:8JSFMFTT)FBU m'GJYFE UFNQFSBUVSF BOE#8CBTF WSK-HEAT-ROR:8JSFMFTTIFBU 303 m'GJYFEUFNQFSBUVSF BOE#8 CBTF WSK-MONITOR:8JSFMFTTNPOJUPSNPEVMF WSK-RELAY:8JSFMFTTSFMBZNPEVMF W-USB:48*'55PPMT64#USBOTDFJWFSVTFE GPSDPNNVOJDBUJPOXJUI48*'5EFWJDFT SBUS ACCESSORIES 5496:"BNQOPUJGJDBUJPOQPXFSFYQBOEFS XJUIGPVSQPXFSMJNJUFEOPUJGJDBUJPO BQQMJBODFDJSDVJUPVUQVUT 5883:3FMBZ*OUFSGBDF1SPWJEFT'PSN$ SFMBZT 5824:4FSJBM1BSBMMFM1SJOUFS*OUFSGBDF .PEVMFGPSQSJOUFSDPOOFDUJPO 5895XL:1PXFS4VQQMZXJUITJY'MFYQVUƇ DJSDVJUT BOEUXP'PSN$SFMBZT.BYQFS TZTUFN 5815RMK:3FNPUFNPVOUJOHLJU %JNFOTJPOTŠ8YŠ)YŠ% COMMUNICATION OPTIONS CELL-CAB-SK:$FMMVMBSDPNNVOJDBUPS NFUBMFODMPTVSFXJUIMPDLLFZ CELL-MOD:$FMMVMBSDPNNVOJDBUPS QMBTUJD FODMPTVSF 4PMFQBUI QPXFSFECZQBOFM IPGSM-4G:%VBMQBUIGJSFBMBSN DPNNVOJDBUPS DFMMVMBSBOEPS*1 QSJNBSZPS CBDLVQ TFMFDUBCMF SK-IP-2:3FNPUFSFQPSUJOHWJBUIF*OUFSOFU 3FRVJSFTB7JTPS"MBSNkSFDFJWFSBUUIFDFOUSBM TUBUJPO MISC. ACCESSORIES SK-NIC:/FUXPSL*OUFSGBDF$BSE1SPWJEFTB DPNNPODPNNVOJDBUJPOTMJOLGPSUIF SK-NIC-KIT:*OTUBMMBUJPO"DDFTTPSZ,JU SK-FML:'JCFS0QUJD.VMUJ.PEF USBOTNJUUFSBOESFDFJWFS SK-FSL:'JCFS0QUJD4JOHMF.PEF RBB:3FNPUFCBUUFSZCPYBDDFTTPSZDBCJOFU GPSCBUUFSJFTUIBUBSFUPPMBSHFUo fiUJOUIF '"$1DBCJOFU%JNFOTJPOTŠ8YŠ)Y Š% NN8YNN)YNN% SK-SCK:4FJTNJD$PNQMJBODF,JUVTFEUP TFDVSFMZGBTUFOCBUUFSJFTUPUIe fiSFQBOFM 1BHFPGŘ# 'MFYQVUk )POFZXFMMk +VNQ4UBSUk 4JMFOU,OJHIUk 48*'5k BOE4ZTUFN 4FOTPSkBSFSFHJTUFSFE USBEFNBSLTPG)POFZXFMM *OUFSOBUJPOBM*OD )PDIJLJkJTBSFHJTUFSFE USBEFNBSLPG)PDIJLJ $PSQPSBUJPO.JDSPTPGUk BOE8JOEPXTkBSF SFHJTUFSFEUSBEFNBSLTPG .JDSPTPGU$PSQPSBUJPO 5IJTEPDVNFOUJTOPU JOUFOEFEUPCFVTFEGPS JOTUBMMBUJPOQVSQPTFT8F USZUPLFFQPVSQSPEVDU JOGPSNBUJPOVQUP EBUFBOEBDDVSBUF8F DBOOPUDPWFSBMMTQFDJGJD BQQMJDBUJPOTPSBOUJDJQBUF BMMSFRVJSFNFOUT"MM TQFDJGJDBUJPOTBSFTVCKFDU UPDIBOHFXJUIPVUOPUJDF 'PS5FDIOJDBM4VQQPSU DBMM 5FDIOJDBM4QFDJGJDBUJPOT PHYSICAL Overall Dimensions:Š8YŠ)YŠ% Shipping Weight:MCT Color:3FE ENVIRONMENTAL Operating Temperature:m'UPm' m$UP m$ Humidity:UPSFMBUJWFIVNJEJUZ OPO DPOEFOTJOH ELECTRICAL 6808 Primary AC:7"$!)[ "5PUBM "DDFTTPSZ-PBE"!7%$QPXFSMJNJUFE Standby Current:N" Alarm Current:N" Battery Charging Capacity:UP") Battery Size:")UP")NBYBMMPXFEJODPOUSPM QBOFMDBCJOFU-BSHFSDBQBDJUZCBUUFSJFTDBOCF IPVTFEJO3##BDDFTTPSZDBCJOFU Honeywell Silent Knight $MJOUPOWJMMF3PBE /PSUIGPSE $5 ]#] g)POFZXFMM*OUFSOBUJPOBM*OD NOTIFICATION APPLIANCE CIRCUITS (NACs) Four programmable circuits which can be programmed individually as: NACs:"!7%$QFSDJSDVJU QPXFSMJNJUFE XJUIBNBYJNVNDVSSFOUPG" Auxiliary Power Circuits:"!7%$QFSDJSDVJU QPXFSMJNJUFE 4VQQPSUT$MBTT# 4UZMF BOE$MBTT" 4UZMFPS DPOfiHVSBUJPOGPSUIF4-$ WIRING:4FFUIFQSPEVDUNBOVBMGPSXJSJOHEFUBJMT The DocBox Store Fire-Panel, Maintenance & As-Built Documents BW-DocBox (15”W x 13”H x 4” D) includes: • Three labels: “Fire Alarm Documents” “As-Built Permits” “Test and Maintenance Documents” • An adjustable bungee allows you to fi t various sizes of binders, documents, smoke-cans, etc. • A door bracket holds two CDs, three sets of keys and more documents • A cam lock with two keys BW-DocBox2 (11”W x 15”H x 4” D) Smaller and more basic model without the door bracket for CDs and key sets. However, it does have the three labels, adjustable bungee and a lock with two keys. It’s often important, or even required that you store documents near fire panels or other systems you’ve installed. 5 BW-DocBox2 Don’t see the box you want? Call us or visit our website BW-DocBox Four boxes in one! The door can be left blank, or one of the three labels may be used. 800-473-0213 E-mail: info@mierproducts.com Customization, special colors, and/or silk-screening of logos are available for quantities of 25 or more. (requires lead time) The BW-DocBox is the easy answer! FEATURES & BENEFITS • UL Listed for 6 amps of notification power • Power supply’s advanced switch mode design reduces damaging heat and manages power up to 50% more efficiently than other systems • 24 VDC filtered output voltage • Built-in synchronization for appliances from Gentex, AMSECO, System Sensor, and Wheelock • Four power-limited notification outputs; 2 Class A or 4 Class B, or 1 Class A and 2 Class B • NACs are programmable as notification appliance circuits, or as auxiliary power to be used as constant, resettable, or door holder power • 3 amps per output circuit • Ground fault detector • CSFM approved • Communicates to the FACP via 4-wire SBUS (wire runs up to 6000 ft) • AC loss delay option shuts off power to non-essential high current accessories like magnetic door holders • MEA approved • Lightweight design adds to ease of installation and reduces shipping costs • ANSI Cadence pattern output capability built-in • UL 864,1481 & 1971 listed • OSHPD (CA) OSP-0065-10 (see accessories) 5496 Intelligent Power Module The 5496 intelligent power module is the most cost-effective power supply available today. It delivers 6 amps of notification appliance circuit power and built-in synchronization for appliances from System Sensor®,Gentex®, AMSECO, and Wheelock®. The 5496’s advanced microprocessor design is years ahead of the competition. Its switch mode power supply design is up to 50% more efficient than competitive linear mode power supplies. The 5496 is a 6 amp notification power expander that provides its own AC power connection, battery charging circuit, and backup battery for use with the Honeywell Silent Knight series fire alarm control panels (FACPs). The 5496 is the cost-effective solution for powering notification appliances required by the Americans with Disabilities Act (ADA). The 5496 has built-in ANSI cadence pattern. The output circuits can be programmed as notification appliance circuits, or as auxiliary power (configurable for constant, resettable, or door holder power). Compatibility The 5496 is compatible with the following Honeywell Silent Knight FACPs: • 6820 / 6820EVS • 5820XL / 5820XL-EVS • 6808 • 6700 • 5808 • 5700 5496 For a complete listing of all compliance approvals and certifications, please visit www.silentknight.com. Microsoft, Windows, and the Windows Logo are registered trademarks or trademarks of Microsoft Corporation. System Sensor® and Honeywell® are registered trademarks of Honeywell International, Inc This document is not intended to be used for installation purposes. We try to keep our product information up-to date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. For Technical Support, call 800-446-6444 5496 Technical Specifications PHYSICAL Overall Dimensions: 16" H x 12.25" W x 3" D (40.6 x 30.9 x 7.6 cm) Shipping Weight: 8.7lbs ENVIRONMENTAL Operating Temperature: 32°F to 120°F (0°C to 49°C) Humidity: 10 to 93% relative humidity (non- condensing) ELECTRICAL: AC Input: 120VAC at 2.7A Output: 24VDC at 6A Standby & Alarm Current: 10mA Notification/Aux. Power Circuits: 4 Output Configuration: 2 Class A (Style Z) 4 Class B (Style Y) 1 Class A & 2 Class B Amps Per Output Circuit: 3.0 (6.0 amps total) Notification Circuit Output: 20.4 – 27.3VDC @ 3.0A each End-of-Line Resistance: 4.7k W EOL resistor required on each Class B circuit Battery Charging Capacity: 7.0 – 35.0AH ORDERING INFORMATION 5496: Intelligent Power Module ACCESSORIES RBB: Remote Battery Box Accessory Cabinet. 16” W x 10” H x 6” D (406 mm W x 254 mm H x 152 mm D) SK-SCK: Seismic Compliance Kit AGENCY LISTINGS AND APPROVALS • CSFM approved • NFPA 72 • UL listed • FM approved • City of NY: 429-90-E Vol XIV Doc 350387| Rev F| 11/17 © 2017 Honeywell International Inc. For more information Learn more about Silent Knight's Product and other products available by visiting www.silentknight.com Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472 800-328-0103 www.silentknight.com SK-HEAT-W SERIES Addressable Heat Detectors The Silent Knight® SK-HEAT-W Series heat detectors are designed for both performance and aesthetics. A new modern, sleek, contemporary design and advanced thermal technologies make the SK-HEAT-W Series ideal for both system operation and building design. The series includes a 135°F/57°C fixed-temperature, rate-of-rise, and a 180°F/88°C fixed high-temperature detectors and are direct replacements for the SK-HEAT Series heat detectors. The point ID address, set using rotary decimal switches, provide specific detector locations. These thermal detectors provide effective, intelligent property protection in a variety of applications. • SK-HEAT-W offers 135°F fixed thermal detection. • SK-HEAT-ROR-W offers 135°F fixed and rate-of-rise thermal detection. • SK-HEAT-HT-W provides fixed high-temperature detection at 190°F. FEATURES AND BENEFITS • Designed to meet UL 268 7th Edition • Sleek and stylish contemporary design • Advanced thermal technology for fast response • Fixed temperature model (SK-HEAT-W) factory preset to 135°F (57°C) •Rate-of-rise model (SK-HEAT-ROR-W), 15°F (8.3°C) per minute • High temperature model (SK-HEAT-HT-W) factory preset to 190°F (88°C) • Addressable by device • Rotary, decimal addressing (Refer to the Silent Knight panel manuals for device capacity) • Two-wire SLC connection • LEDs blink every time the unit is polled • 360°-field viewing angle of the visual alarm indicators (two bi-color LEDs); LEDs blink green in Normal condition and turn on steady red in Alarm • Integral communications and built-in device-type identification • Remote test feature from the panel • Built-in functional test switch activated by external magnet • Walk test with address display (an address of 121 will blink the detector LED 12- (pause)-1) • Low standby current • Built-in tamper-resistant feature • Designed for direct-surface or electrical- box mounting • Sealed against back pressure • Plugs into separate base for ease of installation and maintenance • SEMS screws for wiring of the separate base • Optional remote, single-gang LED accessory • Optional sounder, relay, and isolator bases • Optional flanged surface mounting kit Page 2 of 3 — 351637:B • 7/1/2019 APPLICATIONS Use thermal detectors for protection of property. For further information, refer to manual I56-6529, Applications Manual for System Smoke Detectors, which provides detailed information on detector spacing, placement, zoning, wiring, and special applications. INSTALLATION The SK-HEAT-W Series plug-in intelligent thermal detectors use a separate base to simplify installation, service, and maintenance. Installation instructions are shipped with each detector. Mount base (all base types) on an electrical backbox which is at least 1.5" (3.81 cm) deep. For a chart of compatible junction boxes, see SK-61045. Note: Because of the inherent supervision provided by the SLC loop, end-of-line resistors are not required. Wiring “T-taps” or branches are permitted for Style 4 (Class “B”) wiring. Note: When using relay or sounder bases, consult the SK-ISO installation sheet I56-3627 for device limitations between isolator modules and isolator bases. PRODUCT LINE INFORMATION SK-HEAT-W: White, low-profile intelligent 135°F fixed thermal sensor SK-HEAT-ROR-W: White, low-profile intelligent rate-of-rise thermal sensor SK-HEAT-HT-W: White, low-profile intelligent 190°F fixed thermal sensor B300-6: White, standard flanged low-profile mounting base B300-6-BP: Bulk pack of B300-6, package contains 10 B300-6-IV: Ivory, standard flanged low-profile mounting base B501-WHITE: White, standard European flangeless mounting base B501-BL: Black, standard European flangeless mounting base B501-IV: Ivory, standard European flangeless mounting base B501-WHITE-BP: Bulk pack of B501-WHITE, contains 10 B200S-WH: White, Intelligent, programmable sounder base B200S-IV: Ivory, Intelligent, programmable sounder base B200SR-WH: White, Intelligent sounder base for retrofit applications B200SR-IV: Ivory, Intelligent sounder base for retrofit applications B200S-LF-WH: White, Low Frequency Intelligent, programmable sounder base B200S-LF-IV: Ivory, Low Frequency Intelligent, programmable sounder base B200SR-LF-WH: White, Low Frequency Intelligent sounder base for retrofit applications B200SR-LF-IV: Ivory, Low Frequency Intelligent sounder base for retrofit applications B224RB-WH: White, plug-in System Sensor® relay base B224RB-IV: Ivory, plug-in System Sensor relay base B224BI-WH: White, plug-in System Sensor isolator detector base B224BI-IV: Ivory, plug-in System Sensor isolator detector base ACCESSORIES TR300: White, replacement flange for B210LP or B300-6 bases TR300-IV: Ivory, replacement flange for B210LP or B300-6 bases RA100Z(A): Remote 3 – 32 VDC LED annunciator, mounts to a U.S. single-gang electrical box, for use with B501 and B300-6 bases only M02-04-00: Test magnet M02-09-00: Test magnet with telescoping handle CK300: White, detector color kit, pack of 10 CK300-IV: Ivory, detector color kit, pack of 10 CK300-BL: Black, detector color kit, pack of 10 SK-HEAT-W SERIES TECHNICAL SPECIFICATIONS 351637 | B | 07/19 ©2019 Honeywell International Inc. Silent Knight® and System Sensor® are registered trademarks of Honeywell International, Inc. This document is not intended to be used for installation purposes. We try to keep our product information up-to-date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. Country of origin: Mexico PHYSICAL/ENVIRONMENTAL Size: 2.0" (5.3 cm) high; base determines diameter -B300-6: 6.1" (15.6 cm) diameter -B501: 4" (10.2 cm) diameter For a complete list of detector bases, see SK-61045. Operating temperature range: SK-HEAT-W, SK-HEAT-ROR-W: -4°F to 100°F (-20°C to 38°C) SK-HEAT-HT-W: -4°F to 150°F (-20°C to 66°C) Detector spacing: UL approved for 50 ft. (15.24 m) center to center; FM approved for 25 x 25 ft. (7.62 x 7.62 m) spacing Relative humidity: 10% – 93% non- condensing Thermal ratings: Fixed-temperature set point 135°F (57°C), rate-of-rise detection 15°F (8.3°C) per minute, high temperature heat 190°F (88°C) ELECTRICAL SPECIFICATIONS Voltage range: 15 - 32 volts DC peak Standby current (max. avg.): 200uA @ 24 VDC (one communication every 5 seconds with LED enabled) LED current (max.): 4.5mA @ 24 VDC (“ON”) Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472-1610 203.484.7161 www.silentknight.com AGENCY LISTINGS AND APPROVALS These listings and approvals apply to the modules specified in this document.In some cases, certain modules or applications may not be listed by certain approval agencies, or listing may be in process. Consult factory for latest listing status. •UL Listed: S6228 • FM Approved •CSFM: 7270-0559:0511 Addressable Devices OSI-RI-SK Intelligent Single-ended Reflective Imaging Beam Smoke Detector The OSI-RI-SK single-ended beam smoke detector is easy to install and adjust. Only the head unit needs to be wired, and the “eyeball” can be aimed without adjusting the detector mounting. General The OSI-RI-SK intelligent addressable reflector-type linear optical beam smoke detector is uniquely suited for protecting large open areas with high ceilings, where spot-type smoke detectors are difficult to install and maintain. Ideal applications are warehouses, atriums, aircraft hangers, sporting arenas and concert halls. The beam operates primarily on the principle of light obscuration using infrared. The OSI-RI-SK detector is a combined transmitter/receiver and is compatible with Silent Knight Addressable Fire Alarm Control Panels. Fast and Easy Alignment Aligning the imager to the reflector is extremely intuitive, fast, and accurate. Both the infrared transmitter and the CMOS imager are contained in a movable “eyeball” – an adjustable lens assembly that can move +/- 20° in the vertical direction and 50° in the horizontal direction. Four LED arrows indicate the direction to move the lens, guiding the user to find the imager’s perfect alignment with the reflector. Once the optimum alignment is found, indicated by all green arrows, the lens is locked with a slide lever. A paintable cover is then placed over the front to secure the lever in locked position. Resistant to Building Movement, Sunlight, and Foreign Object Intrusion The infrared transmitter and receiver imager generates a beam of light towards a high-efficiency reflector. The reflector returns the beam to the receiver where the received signal is analyzed. The change in the strength of the received signal when smoke enters the area between the unit and the reflector is used to determine the alarm condition. The receiver imager has a wide 12° field of view that automatically tracks the reflector in case of building movement or support structure movement. This allows the OSI-RI-SK to be highly resistant to movement, eliminating the number one cause of false alarms and/or faults with traditional beam detectors. FEATURES & BENEFITS • Combined transmitter/ receiver unit • Wide 12° field of view • Fast, easy, and intuitive beam alignment indicated by LED directional arrows • 50° horizontal and 20° vertical beam adjustment • Long range coverage of 16-328 ft (5-100 m) is standard; no separate long-range kit required • Automatic sensitivity threshold level setting • Resistant to building movement; tolerates +/- 1° movement • Resistant to strong light sources; does not alarm when saturated by sunlight • Resistant to solid object intrusion • Remote test station capable for electronic simulated smoke test from ground level • Status LED indicators visible from the front and bottom • Automatic drift compensation • Paintable housing/ cover • Removable plug-in terminal blocks • Built-in imager heater • Optional reflector heater kit available Page 2 of 3 — SK-61052:B • 1/16/2019 Optical filtering, high-speed image acquisition and intelligent software algorithms provide the system with higher levels of stability and with greater resistance to high level lighting variability. This provides better resistance to sunlight in its field of view, helping to prevent false alarms when saturated by sunlight, reflected sunlight or any other very bright light sources. Advanced smoke imaging techniques allow the detector to avoid false alarms from partial and sudden blockage from foreign object intrusion. Time-saving Automatic Sensitivity Setting Unique in the market, the sensitivity of the detector is selected and set automatically at the optimum sensitivity based on the size of the reflector measured in the field of view. Drift Compensation The detector incorporates automatic drift compensation, whereby the detector will adjust its detection thresholds in line with any long-term signal reduction of the beam caused by dust or other contamination of the optical surfaces. Equipped with Built-in Imager Heater The imager ships standard with an internal heating option to prevent condensation on the optical surface. (External power supply required.) OSI-RI-SK Technical Specifications SK-61052 | B | 01/19 ©2019 Honeywell International Inc. Silent Knight® is a registered trademark of Honeywell International Inc. ©2019. All rights reserved. Unauthorized use of this document is strictly prohibited. This document is not intended to be used for installation purposes. We try to keep our product information up-to- date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472-1610 203.484.7161 www.silentknight.com PHYSICAL/OPERATING SPECIFICATIONS Dimensions (Detector): Height 6” (152.4 mm); Width 10” (254 mm); Depth 4.5” (114.3 mm) Dimensions (Reflector): Height 9.06” (230 mm); Width 7.87” (200 mm) Weight (Installed): 2.48 lbs (1.12 kg) Weight (Shipping): 3.91 lbs (1.77 kg) Wire Gauge for Terminals: 14 AWG (2.08 mm²) ELECTRICAL SPECIFICATIONS: OSI-RI-SK Operating Voltage Range: Nominal: 24 VDC Minimum: 15 VDC Maximum: 32.0 VDC Maximum Standby Current: 13 mA @ 32 VDC 14 mA @ 24 VDC 20 mA @ 15 VDC Maximum Alarm Current (LED on): 22 mA @ 32 VDC 15 mA @ 24 VDC 22 mA @ 15 VDC BEAMHKR Voltage Range: 15 to 32 V Maximum Current: 450 mA Max at 32 V Power Consumption: 7.7 W @ 24 V 15 W @ 32 V RTS151KEY Voltage Range: 10.2 to 32 VDC Current Range: : 9 mA Min to 11 mA Max ENVIRONMENTAL SPECIFICATIONS Operating Temperature: UL-Listed for use from 32°F to 100°F (0°C to 37.8°C). Application Temperature Range: -4°F to 131°F (-20°C to +55°C) Humidity Range: 0 to 95% relative humidity, non- condensing OPERATIONAL SPECIFICATIONS Protection Range: 16 ft to 328 ft (5 m to 100 m) Adjustment Angle: 20 degrees vertical, 50 degrees horizontal Sensitivity Levels: Level 1 25%, Level 2 30%, Level 3 40%, Level 4 50% Test/Reset Features: Local alarm test switch, local alarm reset switch, Remote test and reset switch (Compatible with RTS151 and RTS151KEY test stations), OSID-R test filter. Smoke Detector Spacing: On smooth ceilings, 30-60 feet between projected beams and not more than one-half that spacing between a projected beam and a sidewall. Other spacing may be used depending on the ceiling height, airflow characteristics, and response requirements. See NFPA 72 (S524 in Canadian applications). AGENCY LISTINGS UL : S911 FM: PR449231 CSFM: 7260-0559:0515 PRODUCT LINE INFORMATION OSI-RI-SK: Intelligent imaging beam smoke detector including reflector OSP-002: Laser alignment tool OSP-004: Test filter, 10 pack RTS151: Remote test station RTS151KEY: Test and reset station with key lock, flush mount BEAMHKR: Heater kit for the reflector 6500-MMK: Multi-mount accessory for ceiling or wall mounting with additional mounting adjustment SK-PHOTO-W SERIES Addressable Photoelectric Smoke Detectors The Silent Knight® SK-PHOTO-W Series feature a modern design and expanded color options support a variety of contemporary aesthetic demands. In addition, each detector is constructed for exceptional installation and maintenance efficiency. The SK-PHOTO-W Series intelligent plug-in smoke detectors are designed for both performance and aesthetics, and are direct replacements for the SK-PHOTO Series detectors. A new modern, sleek, contemporary design and enhanced optical sensing chamber is engineered to sense smoke produced by a wide range of combustion sources in accordance with more stringent code standards. The SK-PHOTO-W Series detector sensitivity can be programmed in the control panel software. Sensitivity is continuously monitored and reported to the panel. Point ID capability allows each detector’s address to be set with rotary, decimal address switches, providing exact detector location for selective maintenance when chamber contamination reaches an unacceptable level. Dual electronic thermistors add 135°F (57°C) fixed temperature thermal sensing on the SK-PHOTO-T-W. The SK-PHOTO-R-W is a remote test capable detector for use with DNR Series duct detector housings. FEATURES AND BENEFITS • Designed to meet UL 1268 7th Edition • Sleek and stylish contemporary design • Stable communication technique with noise immunity • Addressable by device • Rotary, decimal addressing (Refer to the Silent Knight panel manuals for device capacity) • Two-wire SLC connection • LEDs blink every time the unit is polled • 360°-field viewing angle of the visual alarm indicators (two bi-color LEDs); LEDs blink green in Normal condition and turn on steady red in Alarm • Integral communications and built-in device-type identification • Remote test feature from the panel • Built-in functional test switch activated by external magnet • Walk test with address display (an address of 121 will blink the detector LED 12- (pause)-1) • Low standby current • Built-in tamper-resistant feature • Designed for direct-surface or electrical- box mounting • Sealed against back pressure • Plugs into separate base for ease of installation and maintenance • Expanded color options • SEMS screws for wiring of the separate base • Optional remote, single-gang LED accessory • Optional sounder, relay, and isolator bases Page 2 of 3 — 351634:B • 7/1/2019 INSTALLATION The SK-PHOTO-W Series plug-in intelligent thermal detectors use a separate base to simplify installation, service, and maintenance. Installation instructions are shipped with each detector. Mount base (all base types) on an electrical backbox which is at least 1.5" (3.81 cm) deep. For a chart of compatible junction boxes, see SK-61045. Note: Because of the inherent supervision provided by the SLC loop, end-of-line resistors are not required. Wiring “T-taps” or branches are permitted for Style 4 (Class “B”) wiring. Note: When using relay or sounder bases, consult the SK-ISO installation sheet I56-3627 for device limitations between isolator modules and isolator bases. OPERATION Each SK-PHOTO-W Series detector uses one of the panel’s addresses (total limit is panel dependent) on the Signaling Line Circuit (SLC). It responds to regular polls from the control panel and reports its type and the status. If it receives a test command from the panel (or a local magnet test), it stimulates its electronics and reports an alarm. It blinks its LEDs when polled and turns the LEDs on when commanded by the panel. The SK-PHOTO-W Series offers features and performance that represent the latest in smoke detector technology. PRODUCT LINE INFORMATION Note: “-IV” suffix indicates ivory color. SK-PHOTO-W: White, low-profile photoelectric sensor SK-PHOTO-T-W: White, same as SK-PHOTO-W but includes a built-in 135°F (57°C) fixed-temperature thermal device SK-PHOTO-R-W: White, low-profile intelligent photoelectric sensor, remote test capable, for use with DNR/DNRW B300-6: White, standard flanged low-profile mounting base B300-6-BP: Bulk pack of B300-6, package contains 10 B300-6-IV: Ivory, standard flanged low-profile mounting base B501-WHITE: White, standard European flangeless mounting base B501-BL: Black, standard European flangeless mounting base B501-IV: Ivory, standard European flangeless mounting base B501-WHITE-BP: Bulk pack of B501-WHITE, contains 10 B200S-WH: White, Intelligent, programmable sounder base B200S-IV: Ivory, Intelligent, programmable sounder base B200SR-WH: White, Intelligent sounder base for retrofit applications B200SR-IV: Ivory, Intelligent sounder base for retrofit applications B200S-LF-WH: White, Low Frequency Intelligent, programmable sounder base B200S-LF-IV: Ivory, Low Frequency Intelligent, programmable sounder base B200SR-LF-WH: White, Low Frequency Intelligent sounder base for retrofit applications B200SR-LF-IV: Ivory, Low Frequency Intelligent sounder base for retrofit applications B224RB-WH: White, plug-in System Sensor® relay base B224RB-IV: Ivory, plug-in System Sensor relay base B224BI-WH: White, plug-in System Sensor isolator detector base B224BI-IV: Ivory, plug-in System Sensor isolator detector base ACCESSORIES TR300: White, replacement flange for B210LP or B300-6 bases TR300-IV: Ivory, replacement flange for B210LP or B300-6 bases RA100Z(A): Remote 3 – 32 VDC LED annunciator, mounts to a U.S. single-gang electrical box, for use with B501 and B300-6 bases only M02-04-00: Test magnet M02-09-00: Test magnet with telescoping handle CK300: White, detector color kit, pack of 10 CK300-IV: Ivory, detector color kit, pack of 10 CK300-BL: Black, detector color kit, pack of 10 SK-PHOTO-W SERIES TECHNICAL SPECIFICATIONS 351634 | B | 07/19 ©2019 Honeywell International Inc. Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472-1610 203.484.7161 www.silentknight.com Silent Knight® and System Sensor® are registered trademarks of Honeywell International, Inc. This document is not intended to be used for installation purposes. We try to keep our product information up-to-date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. Country of origin: Mexico PHYSICAL/ENVIRONMENTAL Sensitivity: -UL Applications: 0.5% to 4.0% per foot obscuration. -ULC Applications: 0.5% to 3.5% per foot obscuration Size: 2.0" (5.3 cm) high; base determines diameter - B300-6: 6.1" (15.6 cm) diameter - B501: 4" (10.2 cm) diameter For a complete list of detector bases, see SK-61045. Shipping weight: 3.4 oz. (95 g) Operating temperature range: • SK-PHOTO-W: 32°F to 122°F (0°C to 50°C) • SK-PHOTO-T-W: 32°F to 100°F(0°C to 38°C) • SK-PHOTO-R-W installed in a DNR/DNRW: -4°F to 158°F (-20°C to 70°C) UL/ULC Listed Velocity Range: 0-4000 ft/ min. (1219.2 m/min.), suitable for installation in ducts Relative humidity: 10% – 93% non- condensing Thermal ratings: fixed-temperature set point 135°F (57°C), rate-of-rise detection 15°F (8.3°C) per minute, high temperature heat 190°F (88°C) ELECTRICAL SPECIFICATIONS Voltage range: 15 - 32 volts DC peak Standby current (max. avg.): 200µA @ 24 VDC (one communication every 5 seconds with LED enabled) Max current: 4.5 mA @ 24 VDC (“ON”) DETECTOR SPACING AND APPLICATIONS Silent Knight recommends spacing detectors in compliance with NFPA 72. In low airflow applications with smooth ceiling, space detectors 30 feet (9.1m). For specific information regarding detector spacing, placement, and special applications refer to NFPA 72. A System Smoke Detector Application Guide, document A05-1003, is available at www.systemsensor.com. AGENCY LISTINGS AND APPROVALS These listings and approvals apply to the modules specified in this document.In some cases, certain modules or applications may not be listed by certain approval agencies, or listing may be in process. Consult factory for latest listing status. •UL Listed: S6173 • FM Approved •CSFM: 7272-0559:0512 FEATURES & BENEFITS • Single contact monitor • SK-Minimon support for Class B (Style B) contact monitor wiring • Small and lightweight size allows for flexible mounting options • Rotary address switches for fast installation • UL Listed • CSFM Listed • FM Approved SK-MINIMON Intelligent Mini Monitor Module The SK-MINIMON is an addressable monitor modules for use with the Honeywell Silent Knight fire alarm control panels (FACPs). The SK- MINIMON acts as an interface to contact devices, such as waterflow switches and pull stations. The SK-MINIMON supports Class B supervised wiring to the load device. Conventional 4-wire smoke detectors can be monitored for alarm and trouble conditions The SK-MINIMON can be mounted in a single gang junction box directly behind the monitored device. Its small size and light weight allow it to be installed without rigid mounting requirements. INSTALLATION The SK-MINIMON can be mounted in a single gang junction box directly behind the monitored device. Its small size and light weight allow it to be installed without rigid mounting requirements. SK-MINIMON For a complete listing of all compliance approvals and certifications, please visit www.silentknight.com. Microsoft, Windows, and the Windows Logo are registered trademarks or trademarks of Microsoft Corporation. Silent Knight®, System Sensor® and Honeywell® are registered trademarks of Honeywell International, Inc. This document is not intended to be used for installation purposes. We try to keep our product information up-to date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. For Technical Support, call 800-446-6444. SK-MINIMON Technical Specifications PHYSICAL Dimensions: 2.75” W x 1.3" H x 0.5" D Weight: 1.2 oz (37 g) ELECTRICAL Operating Voltage: 15 – 32VDC SLC Standby and Alarm Current: 350 μ A End-of-Line Resistance: 47K W Initiating device circuit wiring resistance: 1,500 W max SLC loop resistance: 40W max Wire Length: 6” min. ENVIRONMENTAL Operating Temperature: 32ºF – 120ºF (0ºC – 49ºC) Humidity: 10% – 93% non-condensing ORDERING INFORMATION SK-MINIMON: Mini monitoring module COMPATIBILITY The SK-MINIMON is compatible with the following Honeywell Silent Knight fire alarm control panels: 6820: Addressable fire alarm control panel 6820EVS: Addressable fire alarm control panel with an emergency voice system. 6808: Addressable fire alarm control panel 6700: Addressable fire alarm control panel 5700: Addressable fire alarm control panel 5808: Addressable fire alarm control panel 5820XL: Addressable fire alarm control panel 5820XL-EVS: Addressable fire alarm control panel with an emergency voice system Doc 350133 | Rev G | 11/17 © 2017 Honeywell International Inc. For more information Learn more about Honeywell Silent Knight and other products by visiting www.silentknight.com Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472 800-328-0103 FEATURES & BENEFITS • Single contact monitor • Support for Class A and Class B wiring • Fully supervised • Panel controlled status LED that flashes green in normal state and is solid red in alarm • SEMS screws for easy wiring • UL Listed • Rotary address switches for fast installation SK-MONITOR Intelligent Monitor Module The SK-MONITOR is an addressable monitor module for use with Honeywell Silent Knight Series fire alarm control panels (FACPs). The SK-MONITOR is intended for use in intelligent, two-wire systems, where individual address of each module is selected using the built-in rotary switches. The SK-MONITOR supports Class A supervised or Class B supervised wiring to the load device. Conventional 4-wire smoke detectors can be monitored for alarm and trouble conditions. INSTALLATION The SK-MONITOR mounts directly into a 4” square electrical box. The box must have a minimum depth of 2-1/8”. A surface mount electrical box (System Sensor® PN SMB500) is available from Silent Knight.SK-MONITOR For a complete listing of all compliance approvals and certifications, please visit www.silentknight.com. Microsoft, Windows, and the Windows Logo are registered trademarks or trademarks of Microsoft Corporation. Silent Knight®, System Sensor® and Honeywell® are registered trademarks of Honeywell International, Inc. This document is not intended to be used for installation purposes. We try to keep our product information up-to date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. For Technical Support, call 800-446-6444. SK-MONITOR Technical Specifications PHYSICAL Height: 4.5”H x 4” W x 1.25”D (11.4 X 10.2 X 3cm) Shipping Weight: 6.3 oz (196 g) ELECTRICAL Operating Voltage: 15 – 32VDC Current Draw (LED on): 5.0mA max Operating Current (LED flashing): 375 μ A Standby Current: 400 μ A max @ 24 VDC (one communication every 5 sec with 47K EOL); 550 μ A max @ 24 VDC (one communication every 5 sec with EOL <1K) 5.5 mA (with LED latched on) LED Current: 5.5 mA (with LED latched on) End-of-Line Resistance: 47K W Initiating Device Circuit Wiring Resistance: 1,500 W max SLC Loop Resistance: 40 W max. ENVIRONMENTAL Operating Temperature: 32ºF – 120ºF (0ºC – 49ºC) Humidity: 10% – 93% non-condensing ORDERING INFORMATION SK-MONITOR: Monitor Module ACCESSORIES. SMB500: 4” Square surface mount electrical box COMPATIBILITY The SK-MONITOR is compatible with the following Honeywell Silent Knight fire alarm control panels: 6820: Addressable fire alarm control panel 6820EVS: Addressable fire alarm control panel with an emergency mass notification system. 6808: Addressable fire alarm control panel 6700: Addressable fire alarm control panel 5700: Addressable fire alarm control panel 5808: Addressable fire alarm control panel 5820XL: Addressable fire alarm control panel 5820XL-EVS: Addressable fire alarm control panel with an emergency mass notification system Doc 350131 | Rev G | 11/17 © 2017 Honeywell International Inc. For more information Learn more about Honeywell Silent Knight and other products by visiting www.silentknight.com Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472 800-328-0103 FEATURES & BENEFITS • Monitor two circuits, with unique addresses, simultaneously • Support for Class B wiring • Fully supervised • Panel controlled status LED that flashes green in normal state and is solid red in alarm • Attractive ivory cover plate • Rotary address switches for fast installation • SEMS screws for easy wiring SK-MONITOR-2 Addressable Dual Monitor Module The SK-MONITOR-2 module is capable of monitoring two separate Class B circuits simultaneously, making it ideal for waterflow tamper switch and flow switch monitoring. The SK-MONITOR-2 is an addressable monitor module with two initiating circuits for use with Honeywell Silent Knight series fire alarm control panels (FACPs). The SK-MONITOR-2 acts as an interface to contact devices, such as waterflow switches and pull stations. The SK-MONITOR-2 supports Class B supervised wiring to the load device. Conventional 4-wire smoke detectors can be monitored for alarm and trouble conditions.. INSTALLATION SK-MONITOR-2 mounts directly into a 4” square electrical box. The box must have a minimum depth of 2-1/8”. A surface mount electrical box (System Sensor® part number SMB500) is available from Silent Knight. SK-MONITOR-2 For a complete listing of all compliance approvals and certifications, please visit www.silentknight.com. Microsoft, Windows, and the Windows Logo are registered trademarks or trademarks of Microsoft Corporation. Silent Knight®, System Sensor® and Honeywell® are registered trademarks of Honeywell International, Inc. This document is not intended to be used for installation purposes. We try to keep our product information up-to date and accurate. We cannot cover all specific applications or anticipate all requirements. All specifications are subject to change without notice. For Technical Support, call 800-446-6444. SK-MONITOR-2 Technical Specifications PHYSICAL Height: 4.5” H x 4” W x 1.25” D Shipping Weight: 6.3 oz (196 g) ELECTRICAL Operating Voltage: 15 – 32 VDC Standby and Alarm Current: 750 μ A max @ 24VDC (one communication every 5 sec with 47K EOL) End-of-Line Resistance: 47K W ENVIRONMENTAL Operating Temperature: 32ºF – 120ºF (0ºC – 49ºC) Humidity: 10% – 93% non-condensing ORDERING INFORMATION SK-Monitor-2: Dual Monitoring Module ACCESSORIES. SMB500: 4” Square Surface Mount Electrical Box AGENCY LISTINGS AND APPROVALS UL Listed CSFM Approved City of New York Approved COMPATIBILITY The SK-MONITOR-2 is compatible with the following Honeywell Silent Knight fire alarm control panels: 6820: Addressable fire alarm control panel 6820EVS: Addressable fire alarm control panel with an emergency mass notification system. 6808: Addressable fire alarm control panel 6700: Addressable fire alarm control panel 5700: Addressable fire alarm control panel 5808: Addressable fire alarm control panel 5820XL: Addressable fire alarm control panel 5820XL-EVS: Addressable fire alarm control panel with an emergency mass notification system. Doc 350124| Rev E | 11/17 © 2017 Honeywell International Inc. For more information Learn more about Honeywell Silent Knight and other products by visiting www.silentknight.com Honeywell Silent Knight 12 Clintonville Road Northford, CT 06472 800-328-0103 Two initiating device circuits NFPA Stlye B Power limited 230 µA Max @ 12VDC max OperationThe single-action pull-station isactivated by a single pull-down ofthe alarm handle. The dual-actionversions require pushing in thehandle, then pulling the handledown for activation. The PS-DA/PS-SA manual pull stations areULlisted and meet the ADArequirement of a 5-lbs. maximumpull force to activate. Operatinginstructions are molded into thehandle along with Braille text.Molded terminal numbers can befound adjacent to the wiring termi-nals.Models:PS-SA–Single action with ‘pigtail’connections and a key lock reset.Pigtail wires are provided for con-nection to the Fire Alarm ControlPanel’s (FACP) initiation circuit.PS-DA –Dual action model withscrew terminal connections and akey lock reset.PS-DAH –Same as PS-DA exceptwith hex lock reset. PS-DALOB –Same as PS-DA with“outdoor use” listing. Includes SB-I/O backbox and sealing gasket.PS-DASP –Same as PS-DAexcept with both English andSpanish operating instructions. Features:•UL Listed• CSFM Listed• Meets ADA requirements• Operating instructions are mold-ed into the handle along withBraille text.• Made of durable Lexan• Available in Spanish• Key resettable• Easy to Install and operate• Single or dual action•Surface mount box available Specification:Dimensions:Height: 5-1/2” (13.97 cm)Width: 4” (10.16 cm)Depth:1-7/16” (3.65 cm)Operatingtemperature:32°F to 120°F(0°C to 49°C)Electrical:Switch ContactRating: 0.25 A @ 30 VAC or VDCAccessories:SB-I/O Surface Mount Back-boxBG-TR Trim Ring PS-DA and PS-SAConventional Pull-stations The PS-DA/PS-SA Pull Stations are non-coded manual pull stations which provide a Fire Alarm Control Panel(FACP) with a single alarm initiating input signal. The PS-DA/PS-SA pull stations includes both single-action anddual-action models equipped with key lock / reset. It was designed to meet multiple applications with the installerand end-user in mind. Its innovative design, durable construction, and multiple mounting options make the PS-DA and PS-SA simple to install, maintain, and operate. Easy to Install and Operate PS-DA PS-DASP CONVENTIONAL FIRE CONTROL PANEL ACCESSORY CONVENTIONAL FIRE CONTROL PANEL ACCESSORY PS-DA and PS-SAConventional Pull-Stations Engineering Specification Manual Fire Alarm Stations shall be non-code, with a key-operated reset lock in order that they may be tested,and so designed that after actual Emergency Operation, they cannot be restored to normal except by use of akey. An operated station shall automatically condition itself so as to be visually detected as activated. Manualstations shall be constructed of red colored LEXAN® (or polycarbonate equivalent) with clearly visible operatinginstructions provided on the cover. The word FIRE shall appear on the front of the stations in white letters, 1.00inches (25.4 mm) or larger.* Stations shall be suitable for surface mounting on matching back-box SB-10; orsemi-flush mounting on a standard single-gang, double-gang, or 4" (10.16 cm) square electrical box, and shallbe installed within the limits defined by the Americans with Disabilities Act (ADA) or per national/local require-ments. Manual Stations shall be Underwriters Laboratories listed.*NOTE:The words “FIRE/FUEGO” on the PS-DASP shall appear on the front of the station in white letters,approximately 3/4" high. PS-SA Front View PS-DA Front View PS-SA Rear View PS-DA Rear View MADE IN AMERICA P/N 350241 Rev.D©2011 Honeywell International Inc. This document is not intended to be used for installation purposes. We try tokeep our product information up-to-date and accurate. We cannot cover allspecific applications or anticipate all requirements. All specifications are sub-ject to change without notice. For more information, contact Silent Knight 12Clintonville Road Northford, CT 06472-1610 Phone: (800) 328-0103, Fax: (203) 484-7118. www.silentknight.com DescriptionThe PS-DATK and PS-SATK manu-al pull stations feature high-quality,die cast metal construction. Theyare available in either single or dualaction configurations with SPSTswitch, and terminal strip connec-tions. The normally open contact,which closes when the pull stationis activated, is rated for 1 amp, at125 VAC or 30 VDC. The contactsare gold-plated to avoid risk of cor-rosion. All models in the serieshave been tested by UL for compli-ance to the latest requirements ofthe Americans with Disabilities Act(ADA).Features•UL listed•CSFM approved•MEA (BSA) approved•ADA compliant•Weatherproof model approvedfor outdoor use•Single or dual action•Terminal connections•Reset using the same keys asSilent Knight enclosures•Surface mount backboxes avail-able•High-gloss red enamel finish ondie cast metal•Corrosion-resistant gold-platedcontacts OperationThe single action pull stations areoperated by simply pulling the han-dle on the front of the Station as fardown as it will go, at which pointthe handle locks into place and iseasily visible from up to 50 feet. Ascored acrylic break rod is alsosupplied with each unit for applica-tions where it is necessary. thehandle is reset by opening the sta-tion with a key, placing the handlein the normal upright position andrelocking the station.On the dual action models, pushingthe PUSH bar causes it to rotateinward, allowing the PULL handleto be grasped in a one-handedmotion. The dual action models arealso supplied with break rods. Dualaction models are reset in thesame way as a single actionmodel.The weatherproof version of thepull stations is provided with a gas-ket and die cast metal backboxtapped on one end for 1/2” conduit,for surface mounting. PS-SATKSingle Action Pull Station PS-DATKDual Action Pull Station Die Cast MetalManual Pull Stations A manual pull station doesn’t have to be fancy—just tough, reliable and extremely easy to operate. SilentKnight’s die cast metal pull stations are all three. they’re the high-quality choice for fast, sure initiation of a firealarm signal.Our manual pull stations feature rugged, die cast metal construction that lasts and lasts. they’re available in sin-gle or dual action models. And the Silent Knight PS-SATK and PS-DATK pull stations are UL-Listed, CSFMApproved, and MEA (BSA) Approved. For outdoor use, a weatherproof model is also available.On your next job, make the high-quality choice—Silent Knight manual pull stations. For more information, oradditional information on our complete fire products line, call Silent Knight at 1-800-328-0103. Silent Knight die cast metal manual pull stations put quality and peace of mind in easy reach FIRE ALARM INITIATING DEVICE FIRE ALARM INITIATING DEVICE PS-DATK and PS-SATKDie Cast Metal Manual Pull Stations Engineering Specification The PS-SATK and PS-DATK manual pull stations are die cast metal construction painted with red enamel. The pull stationscontain the word FIRE in two locations on the front of the units as well as the Silent Knight company logo. Operating instruc-tion are clearly visible on the front of the units. These manual stations contain a key operated reset lock, using a lock plateactuator. The reset key and lock shall be the same as used on the FACP.These manual stations shall contain two terminals for connection to the conventional fire detection loops. Manual stations shall be Underwriters Laboratories Inc. listed and installed within the limits defined in the AmericanDisabilities Act . MADE IN AMERICA P/N 350792 Rev. C© 2014 Honeywell International Inc. This document is not intended to be used for installation purposes. We try tokeep our product information up-to-date and accurate. We cannot cover allspecific applications or anticipate all requirements. All specifications are sub-ject to change without notice. For more information, contact Silent Knight 12 Clintonville Road Northford, CT 06472-1610 Phone: (800) 328-0103, Fax: (203) 484-7118. For Technical Support, please call 800-446-6444.www.silentknight.com SpecificationsSwitch Rating:1 amp at 125 VAC, or 30 VDC.Pull StationDimensions:4-3/4” H x 3-1/4” W x 1-1/8” DSurface MountBackbox Dimensions:4-3/4” H x 3-1/4” W x 2-1/4” D (cast and sheet metal).Color:Red with raised white letters, white PULL bar with raised red letters.Accessories:All models are supplied with one scored acrylic break-rod and a key. Ordering InformationModelDescriptionPS-SATK Pull Station, Single Action, Terminal Connection, Key ResetPS-DATK Pull Station, Dual Action, Terminal Connection, Key ResetPS-SATK-WP Pull Station, Single Action, Terminal Connection, Key Reset, Weatherproof BoxPS-WPB Weatherproof BoxPS-BB Back BoxPS-GR-12 Box of 12 Scored Acrylic Break Rods Agency Listings S2522 3034401 7300-1653:0212 7300-1653:0211 7135-1653:0196 9080301 Duct Smoke Detector Accessories Expand the versatility of the InnovairFlex™ line of duct smoke detectors with System Sensor notification and test accessories. Available Accessories APA151 Piezo Annunciator MHR Mini-Horn, Red MHW Mini-Horn, White RA100Z/RA100ZA Remote Annunciator RTS151 Remote Test Station RTS151KEY Remote Test Station with Key RTS2 Multi-Signaling Accessory AOS Add-On Strobe RTS2-AOS Multi-Signaling Accessory Duct smoke detector accessories add functionality to the duct smoke detection system by allowing quick, convenient inspections at eye level and effective audible and visible notification options. All System Sensor duct smoke detectors and accessories are UL listed. The APA151 piezo annunciator, which replaces the APA451 with a new, improved look, provides an audible alarm signal, a red LED to indicate alarm status, and a green LED to indicate power status. It is intended for use with System Sensor 4-wire conventional duct smoke detector applications without a system control panel, to comply with NFPA 90A. The MHR and MHW SpectrAlert® Advance mini-horns feature temporal or continuous tones at high and low volume settings. Their small footprint allows mounting to single-gang back boxes for applications where a small device is desired. The RA100Z and RA100ZA remote annunciators are designed for both conventional and intelligent applications. Their red LED provides visual indication of an alarm condition. The RTS151 and RTS151KEY remote test stations are automatic fire detector accessories designed to test duct smoke detectors from a convenient location. For 4-wire detectors, the RTS151KEY test station features a multi-colored LED that alternates between steady green and red. For 2-wire detectors, the LED illuminates red for alarm. The RTS2 and RTS2-AOS multi-signaling accessories are designed to work with InnovairFlex 4-wire conventional duct smoke detectors. These accessories include a key switch that can be used to select one of two connected sensors to be tested, reset, or both by a push button switch. They also enable sensitivity measurements using the SENS-RDR sensitivity reader (sold separately). The AOS (Add-On Strobe) is an optional accessory included with the RTS2- AOS model. 3825 Ohio Avenue • St. Charles, IL 60174 Phone: 800-SENSOR2 • Fax: 630-377-6495 www.systemsensor.com ©2013 System Sensor. Product specifications subject to change without notice. Visit systemsensor.com for current product information, including the latest version of this data sheet. HVDS20202 • 8/13 APA151 Piezo Annunciator Voltage Regulated 24 VDC Operating Voltage 16 to 33 VDC Maximum Alarm Current 30 mA Temperature Range 0°C to 49°C (32°F to 120°F) Relative Humidity 10 to 93% non-condensing Wire Gauge 12 to 18 AWG Dimensions 4.6˝ H × 2.9˝ W × .45˝ D MHR/MHW SpectrAlert® Advance Mini-Horns Voltage Regulated 12 DC or FWR (Full Wave Rectified) or Regulated 24 VDC or FWR Sounder Current Draw 22 mA RMS max. at 8 to 17.5 Volts DC 29 mA RMS max. at 16 to 33 Volts DC Temperature Range 0°C to 49°C (32°F to 120°F) Humidity Range 10 to 93% non-condensing Nominal Sounder Frequency 3 kHz Wire Gauge 12 to 18 AWG Dimensions 4.6˝ H × 2.9˝ W × 0.45˝ D RA100Z/RA100ZA Remote Annunciator Voltage Range Conventional System: 3.1 to 32 VDC Intelligent System: 18 to 32 VDC Maximum Alarm Current 10 mA Dimensions 4.6 ˝ H × 2.8˝ W × 1.3˝ D Specifications, Duct Smoke Detector Accessories RTS151 Remote Test Station Power Requirements Alarm LED: 2.8 to 32 VDC, 12 mA max. Total Current: 105 mA max. Test Switch 10 VA @ 32 VDC Reset Switch 10 VA @ 32 VDC Alarm Response Time 40 seconds max. Temperature Range –10°C to 60°C (14°F to 140°F) Relative Humidity 95% non-condensing Wire Gauge 14 to 18 AWG Dimensions 4.8˝ H x 2.90˝ W x 1.4˝ D RTS151KEY Remote Test Station with Key Power Requirements Power LED (Green): 14 to 35 VDC, 12 mA max. Alarm LED (Red): 2.8 to 32 VDC, 12 mA max. Total Current: 105 mA max. Alarm Response Time 40 seconds max. Temperature Range –10°C to 60°C (14°F to 140°F) Relative Humidity 95% non-condensing Wire Gauge 14 to 18 AWG Dimensions 4.6˝ H × 2.75˝ W × 1.8˝ D RTS2 and RTS2-AOS Multi-signaling Accessory Voltage 20 to 29 VDC Power Requirements Standby: 3.0 mA max. Trouble: 16.0 mA max. Alarm without strobe: 30 mA max. Alarm with strobe: 55 mA max. Sounder 85 dBA at ten feet Temperature Range –10°C to 60°C (14°F to 140°F) Relative Humidity 95% non-condensing Wire Gauge 14 to 22 AWG Dimensions 4.8˝ W x 5.3˝ H x 1.6˝ D For the very latest product specifications and listing information, please visit the System Sensor Web site at www.systemsensor.com. RTS151 UL S4011 RA100Z UL S2522 RTS151KEY UL S2522 MHW UL S4011 MHR UL S4011 APA151 UL S4011 RTS2-AOS UL S2522 AOS 200 Series Mounting Base Options System Sensor mounting bases and kits provide a variety of installation options for detectors in any application. Features • Bases enable quick and secure detector plug-in • SEMS screws provide easy wiring connection • Support for 12-24 AWG provides installation flexibility • Multiple accessory options provide mounting flexibility • Sounder bases are compliant with UL 464 and UL 268 To meet local code and application requirements, System Sensor offers relay, isolator, and sounder base options for 200 Series detectors. Relay bases provide one form C contact relay for control of auxiliary functions, such as door closure and elevator recall. Isolator bases allow loops to continue to operate under fault conditions and automatically restore when the fault is removed. Sounder bases are available in a combination temporal 3 and continuous tone model (B200SR) or an addressable model (B200S) that can be activated by the fire alarm control panel based on the event.† 200 Series Bases provide a variety of mounting options to meet your installation challenges. Bases come in flanged or flangless versions for mounting to a variety of junction boxes. See the 200 Series Junction Box Selection Guide on the next page for junction box options. Surface mounting boxes are also available. Agency Listings Model Listings B501 UL, ULC,* FM, CSFM B210LP UL, ULC, FM, CSFM B200S UL, ULC, FM, CSFM B200SR UL, ULC, FM, CSFM B224RB UL, ULC, FM, CSFM B224BI UL, ULC, FM, CSFM * For ULC-listed products, add “A” to the model number (e.g., B501A). † Consult your fire alarm control panel manufacturer for compatibility with the addressable model of the sounder base. ©2012 System Sensor. Product specifications subject to change without notice. Visit systemsensor.com for current product information, including the latest version of this data sheet. SPDS13801 • 09/12 3825 Ohio Avenue • St. Charles, IL 60174 Phone: 800-SENSOR2 • Fax: 630-377-6495 www.systemsensor.com 200 Series Junction Box Selection Guide Model Single Gang 3.5" Octagonal 4" Octagonal 4" Square 4" Square* 50 mm 60 mm 70 mm 75 mm B501 No Yes No No Yes Yes Yes Yes No B210LP Yes Yes Yes Yes Yes No No Yes No B224RB Yes No Yes Yes Yes No No Yes No B224BI Yes No No Yes Yes No No Yes No B200SR/B200S Yes Yes †Yes Yes Yes †No No Yes No * with 3.0" mud ring † B200SA is not compatitble with this junction box Note: Box depth contingent on base and wire size. Refer to National Electric Code or applicable local codes for appropriate recommendations. Ordering Information, 200 Series Bases Model Description B501* 4" Flangeless Mounting Base B501BP*4" Flangeless Mounting Base Bulk Pack B210LP*6" Flanged Mounting Base B210LPBP*6" Flanged Mounting Base Bulk Pack B200SR*Standard Sounder Base (Compatible with B501BH Series) B200S*Intelligent Addressable Sounder Base B224RB*Relay Base B224BI*Isolator Base 200 Series Accessories SMB600 Surface Mounting Kit (flanged) F110 Accessory Flange Ring for 6" Base F110BP Accessory Flange Ring for 6" Base Bulk Pack F210 Accessory New Smaller Flange Ring for 6” Base RA100Z*Remote LED Annunciator M02-04-00 Detector Test Magnet M02-09-00 Test Magnet with Telescoping Handle XR2B Detector Removal Tool (T55-127-000 included) XP-4 Extension Pole for XR2B (5 to 15 ft.) T55-127-000 Detector Removal Head BCK-200B Black Detector Kit WCK-200B White Detector Kit * Add “A” to model number for ULC-listed product (e.g., B501A) Specifications – 200 Series Bases Physical Specifications Diameter B501: 4.1" (104 mm); B210LP: 6.1" (155 mm); B224BI, B224RB, B200SR, B200S: 6.875" (175 mm) Wire Gauge B224BI, B224RB, B200SR, B200S, B210LP, B501: 24 to 12 AWG Temperature Range Refer to applicable sensor Operating Temperature Range using the Base/Sensor Cross Reference Chart at systemsensor.com Humidity Range 10% to 93% RH non-condensing B224RB/B224BI Electrical Ratings B200SR/B200S Electrical Ratings Operating Voltage 15 to 32 VDC (powered by SLC)External Supply Voltage 16 to 33 VDC (VFWR) Standby Current 170/450 µA max.Standby Current 500 µA max. Set Time (B224RB only)Short Delay: 60 to 100 msec Long Delay: 6 to 10 sec Reset Time (B224RB only)20 msec max. Relay Characteristics (B224RB only) 2 coil latching relay 1 Form C contact UL/ULC Rating: 0.5 A @ 125 VAC 0.9 A @ 125 VDC 3 A @ 30 VDC Sound Output Greater than 90 dBA measured in anechoic room at 10 feet, 24 volts. 85 dBA minimum in UL reverberant room Alarm Current 35 mA max. B200S Addressable Sounder Base Product Overview When used with compatible fire alarm control panels, the B200S sounder base provides unmatched flexibility to configure the output to various events. When combined with System Sensor SpectrAlert® Advance notification appliances, the B200S can serve as a UL464 compliant component of the general evacuation signaling, improving aesthetics and reducing system costs. Features*: • Simple addressing scheme - base adopts the same address as attached sensor • Synchronizable with SpectrAlert Advance notification appliances • Four standard tone patterns at two selectable volumes • Custom tone capability • Support for Temporal-4 CO annunciation * Note: Some features are dependent on Fire Alarm Panel programming. Consult your Fire Alarm Panel manual for more information on the capabilities of your system. Agency Listings 7125-1653:0504 7135-1653:0503 S5512 S4011 FM approved except for ALERT models 3057383, 3057072 AVDS865-05 • 2/22/2018 • Page 1 Features • Updated Modern Aesthetics • Small profile devices for Horns and Horn Strobes • Plug-in design with minimal intrusion into the back box • Tamper-resistant construction • Automatic selection of 12- or 24-volt operation at 15 and 30 candela • Field-selectable candela settings on wall units: 15, 30, 75, 95, 110, 135, and 185 • Horn rated at 88+ dBA at 16 volts • Rotary switch for horn tone and two volume selections • Mounting plate for all standard and all compact wall units • Mounting plate shorting spring checks wiring continuity before device installation • Electrically compatible with legacy SpectrAlert and SpectrAlert Advance devices • Compatible with MDL3 sync module • Strobes and Horn Strobes listed for wall mounting only • Horns listed for wall or ceiling use The System Sensor L-Series offers the most versatile and easy-to-use line of horns, strobes, and horn strobes in the industry with lower current draws and modern aesthetics. With white and red plastic housings, standard and compact devices, and plain, FIRE, and FUEGO-printed devices, System Sensor L-Series can meet virtually any application requirement. The L-Series line of wall-mount horns, strobes, and horn strobes include a variety of features that increase their application versatility while simplifying installation. All devices feature plug-in designs with minimal intrusion into the back box, making installations fast and foolproof while virtually eliminating costly and time-consuming ground faults. To further simplify installation and protect devices from construction damage, the L-Series utilizes a universal mounting plate for all models with an onboard shorting spring, so installers can test wiring continuity before the device is installed. Installers can also easily adapt devices to a suit a wide range of application requirements using field-selectable candela settings, automatic selection of 12- or 24-volt operation, and a rotary switch for horn tones with two volume selections. Indoor Selectable- Output Horns, Strobes, and Horn Strobes for Wall Applications System Sensor L-Series audible visible notification products are rich with features guaranteed to cut installation times and maximize profits with lower current draw and modern aesthetics. AVDS865-05 • 2/22/2018 • Page 2 L-Series Specifications Architect/Engineer Specifications General L-Series standard horns, strobes, and horn strobes shall mount to a standard 2 x 4 x 17/8-inch back box, 4 × 4 × 1½-inch back box, 4-inch octagon back box, or double-gang back box. L-Series compact products shall mount to a single-gang 2 × 4 × 17⁄8 -inch back box. A universal mounting plate shall be used for mounting ceiling and wall products for all standard models and a separate universal mounting plate shall be used for mounting wall compact models. The notification appliance circuit wiring shall terminate at the universal mounting plate. Also, L-Series products, when used with the Sync•Circuit™ Module accessory, shall be powered from a non-coded notification appliance circuit output and shall operate on a nominal 12 or 24 volts. When used with the Sync•Circuit Module, 12-volt-rated notification appliance circuit outputs shall operate between 8.5 and 17.5 volts; 24-volt-rated notification appliance circuit outputs shall operate between 16.5 and 33 volts. Indoor L-Series products shall operate between 32 and 120 degrees Fahrenheit from a regulated DC or full-wave rectified unfiltered power supply. Strobes and horn strobes shall have field-selectable candela settings including 15, 30, 75, 95, 110, 135, and 185. Strobe The strobe shall be a System Sensor L-Series Model _______ listed to UL 1971 and shall be approved for fire protective service. The strobe shall be wired as a primary-signaling notification appliance and comply with the Americans with Disabilities Act requirements for visible signaling appliances, flashing at 1 Hz over the strobe’s entire operating voltage range. The strobe light shall consist of a xenon flash tube and associated lens/reflector system. Horn Strobe Combination The horn strobe shall be a System Sensor L-Series Model _______ listed to UL 1971 and UL 464 and shall be approved for fire protective service. The horn strobe shall be wired as a primary-signaling notification appliance and comply with the Americans with Disabilities Act requirements for visible signaling appliances, flashing at 1 Hz over the strobe’s entire operating voltage range. The strobe light shall consist of a xenon flash tube and associated lens/reflector system. The horn shall have two audibility options and an option to switch between a temporal three pattern and a non-temporal (continuous) pattern. These options are set by a multiple position switch. The horn on horn strobe models shall operate on a coded or non-coded power supply. Synchronization Module The module shall be a System Sensor Sync•Circuit model MDL3 listed to UL 464 and shall be approved for fire protective service. The module shall synchronize Strobes at 1 Hz and horns at temporal three. Also, while operating the strobes, the module shall silence the horns on horn strobe models over a single pair of wires. The module shall mount to a 411/16 × 411/16 × 21/8-inch back box. The module shall also control two Style Y (class B) circuits or one Style Z (class A) circuit. The module shall synchronize multiple zones. Daisy chaining two or more synchronization modules together will synchronize all the zones they control. The module shall not operate on a coded power supply. Physical/Electrical Specifications Standard Operating Temperature 32°F to 120°F (0°C to 49°C) Humidity Range 10 to 93% non-condensing Strobe Flash Rate 1 flash per second Nominal Voltage Regulated 12 DC or regulated 24 DC/FWR1 Operating Voltage Range2 8 to 17.5 V (12 V nominal) or 16 to 33 V (24 V nominal) Operating Voltage Range MDL3 Sync Module 8.5 to 17.5 V (12 V nominal) or 16.5 to 33 V (24 V nominal) Input Terminal Wire Gauge 12 to 18 AWG Wall-Mount Dimensions (including lens)5.6˝ L × 4.7˝ W × 1.91˝ D (143 mm L × 119 mm W × 49 mm D) Compact Wall-Mount Dimensions (including lens)5.26” L x 3.46” W x 1.91” D (133 mm L x 88 mm W x 49 mm D) Horn Dimensions 5.6˝ L × 4.7˝ W × 1.25˝ D (143 mm L × 119 mm W × 32 mm D) Compact Horn Dimensions 5.25” L x 3.45” W x 1.25” D (133 mm L x 88 mm W x 32 mm D) 1. Full Wave Rectified (FWR) voltage is a non-regulated, time-varying power source that is used on some power supply and panel outputs. 2. Strobe products will operate at 12 V nominal only for 15 cd and 30 cd. AVDS865-05 • 2/22/2018 • Page 3 Horn and Horn Strobe Output (dBA) Switch Position Sound Pattern dB 8–17.5 Volts 16–33 Volts DC DC FWR 1 Temporal High 84 89 89 2 Temporal Low 75 83 83 3 Non-Temporal High 85 90 90 4 Non-Temporal Low 76 84 84 5 3.1 KHz Temporal High 83 88 88 6 3.1 KHz Temporal Low 76 82 82 7 3.1 KHz Non-Temporal High 84 89 89 8 3.1 KHz Non-Temporal Low 77 83 83 9*Coded High 85 90 90 10*3.1 KHz Coded High 84 89 89 * Settings 9 and 10 are not available on 2-wire horn strobes. Temporal coding must be provided by the NAC. If the NAC voltage is held constant, the horn output remains constantly on. UL Max. Strobe Current Draw (mA RMS) Candela 8–17.5 Volts 16–33 Volts DC DC FWR Candela Range 15 88 43 60 30 143 63 83 75 N/A 107 136 95 N/A 121 155 110 N/A 148 179 135 N/A 172 209 185 N/A 222 257 UL Max. Current Draw (mA RMS), Wall Horn Strobe, Candela Range (15–185 cd) DC Input 8–17.5 Volts 16–33 Volts 15cd 30cd 15cd 30cd 75cd 95cd 110cd 135cd 185cd Temporal High 98 158 54 74 121 142 162 196 245 Temporal Low 93 154 44 65 111 133 157 184 235 Non-Temporal High 106 166 73 94 139 160 182 211 262 Non-Temportal Low 93 156 51 71 119 139 162 190 239 3.1K Temporal High 93 156 53 73 119 140 164 190 242 3.1K Temporal Low 91 154 45 66 112 133 160 185 235 3.1K Non-Temporal High 99 162 69 90 135 157 175 208 261 3.1K Non-Temporal Low 93 156 52 72 119 138 162 192 242 FWR Input 16–33 Volts 15cd 30cd 75cd 95cd 110cd 135cd 185cd Temporal High 83 107 156 177 198 234 287 Temporal Low 68 91 145 165 185 223 271 Non-Temporal High 111 135 185 207 230 264 316 Non-Temportal Low 79 104 157 175 197 235 283 3.1K Temporal High 81 105 155 177 196 234 284 3.1K Temporal Low 68 90 145 166 186 222 276 3.1K Non-Temporal High 104 131 177 204 230 264 326 3.1K Non-Temporal Low 77 102 156 177 199 234 291 UL Max. Horn Current Draw (mA RMS) Sound Pattern dB 8–17.5 Volts 16–33 Volts DC DC FWR Temporal High 39 44 54 Temporal Low 28 32 54 Non-Temporal High 43 47 54 Non-Temporal Low 29 32 54 3.1 KHz Temporal High 39 41 54 3.1 KHz Temporal Low 29 32 54 3.1 KHz Non-Temporal High 42 43 54 3.1 KHz Non-Temporal Low 28 29 54 Coded High 43 47 54 3.1 KHz Coded High 42 43 54 UL Current Draw Data Horn Tones and Sound Output Data 3825 Ohio Avenue • St. Charles, IL 60174 Phone: 800-SENSOR2 • Fax: 630-377-6495 www.systemsensor.com ©2018 System Sensor. Product specifications subject to change without notice. Visit systemsensor.com for current product information, including the latest version of this data sheet. AVDS865-05 • 2/22/2018 L-Series Dimensions Model Description Wall Horn Strobes P2RL 2-Wire, Horn Strobe, Red P2WL 2-Wire, Horn Strobe, White P2GRL 2-Wire, Compact Horn Strobe, Red P2GWL 2-Wire, Comp 2 fils act Horn Strobe, White P2RL-P 2-Wire, Horn Strobe, Red, Plain P2WL-P 2-Wire, Horn Strobe, White, Plain P2RL-SP 2-Wire, Horn Strobe, Red, FUEGO P2WL-SP 2-Wire, Horn Strobe, White, FUEGO P4RL 4-Wire, Horn Strobe, Red P4WL 4-Wire, Horn Strobe, White Wall Strobes SRL Strobe, Red SWL Strobe, White SGRL Compact Strobe, Red SGWL Compact Strobe, White SRL-P Strobe, Red, Plain SWL-P Strobe, White, Plain SRL-SP Strobe, Red, FUEGO SWL-CLR-ALERT Strobe, White, ALERT L-Series Ordering Information Notes: All -P models have a plain housing (no “FIRE” marking on cover). All -SP models have “FUEGO” marking on cover. All -ALERT models have “ALERT” marking on cover. *Horn-only models are listed for wall or ceiling use. Model Description Horns* HRL*Horn, Red HWL*Horn, White HGRL*Compact Horn, Red HGWL*Compact Horn, White Accessories TR-2 Universal Wall Trim Ring Red TR-2W Universal Wall Trim Ring White SBBRL Wall Surface Mount Back Box, Red SBBWL Wall Surface Mount Back Box, White SBBGRL Compact Wall Surface Mount Back Box, Red SBBGWL Compact Wall Surface Mount Back Box, White 4.70" (11.94 cm)1.91" (4.85 cm) 1.25" (3.18 mm) 5.67" (14.4 cm) A0549-00A0550-00 Compact Strobe, Horn Strobe Compact Horn Strobe, Horn Strobe Horn A0548-00 A0547-00 4.7" 119 mm 5.67" 144 mm 1.25" 32 mm 3.46" 88 mm 1.91" 48.5 mm 1.25" 32 mm 5.27" 133.9 mm 3.46" 88 mm 1.25" 32 mm 5.27" 133.9 mm Wall Surface Mount Back Box SBBRL/SBBWL A0554-01 4.82" (12.24 cm)1.85" (4.69 cm) 5.78" (14.68 cm) A0557-00 1.55" (3.9 cm) 3.57" (9.1 cm) 5.38" (13.7 cm) Compact Wall Surface Mount Back Box SBBGRL, SBBGWL Agency Listings Features • Weatherproof per NEMA 4X, IP56 • Listed to UL 1638 (strobe) and UL 464 (horn) • Compatible with System Sensor synchronization protocol and legacy SpectrAlert products • Field-selectable candela settings: 15, 15/75, 30, 75, 95, 110, 115, 135, 150, 177, and 185 • Automatic selection of 12- or 24-volt operation at 15 and 15/75 candela • Rotary switch for horn tone and three volume selections • Horn rated at 88+ dBA at 16 volts • Rated from –40°F to 151°F • Universal mounting plate with an onboard shorting spring that tests wiring continuity before devices are installed • Plug-in design with minimal intrusion into the back box • Tamper-resistant construction • Listed for ceiling or wall mounting SpectrAlert Advance offers the broadest line of outdoor horns, strobes, and horn strobes in the industry. With white or red plastic housings, wall or ceiling mounting options, and plain or FIRE-printed devices, SpectrAlert Advance can meet virtually any application requirement, including indoor, outdoor, wet, and dry applications in temperatures from −40°F to 151°F. Like the entire SpectrAlert Advance line, outdoor horns, strobes, and horn strobes for wall applications include a variety of features that increase application flexibility and simplify installation. First, field-selectable settings, including candela, automatic selection of 12- or 24-volt operation, horn tones, and three volume options enable installers to easily adapt devices to meet requirements. Next, SpectrAlert Advance devices use a universal mounting plate for both wall and ceiling applications. This mounting plate includes an onboard shorting spring that ensures wiring continuity before devices are installed, so installers can verify proper wiring without mounting the devices and exposing them to potential construction damage. Once the plates are mounted, all SpectrAlert Advance devices utilize a plug-in design with a single captured screw to speed installation and virtually eliminate costly ground faults. Outdoor devices ship with weatherproof plastic back boxes (metal back boxes are available separately) that accommodate in-and- out wiring for daisy chaining devices. Plastic back boxes feature removable side flanges and improved resistance to saltwater corrosion. Knock-outs located on the back eliminate the need to drill holes for screw-in mounting. Plastic and metal weatherproof back boxes come with ¾-inch top and bottom conduit entries and ¾-inch knock-outs at the back. A screw-in NPT plug with an O-ring gasket for a watertight seal is included with each back box. Outdoor Selectable- Output Horns, Strobes, and Horn Strobes for Wall Applications SpectrAlert® Advance outdoor audible visible products are rich with features that cut installation times and maximize profits. MEA452-05-E3023572 7300-1653:187 (outdoor strobes) 7125-1653:188 (horn strobes, chime strobes) 7135-1653:189 (horns, chimes) S4011 (chimes, horn strobes, horns) S3593 (outdoor and alert strobes) AVDS01201 SpectrAlert Advance Outdoor Horn, Strobe, and Horn Strobe Specifications Architect/Engineer Specifications General SpectrAlert Advance outdoor horns, strobes, and horn strobes shall mount to a weatherproof back box. A universal mounting plate shall be used for mounting ceiling and wall products. The notification appliance circuit wiring shall terminate at the universal mounting plate. Also, SpectrAlert Advance products, when used with the Sync•Circuit™ Module accessory, shall be powered from a non-coded notification appliance circuit output and shall operate on a nominal 12 or 24 volts. When used with the Sync•Circuit Module, 12-volt-rated notification appliance circuit outputs shall operate between 9 and 17.5 volts; 24-volt-rated notification appliance circuit outputs shall operate between 17 and 33 volts. Outdoor SpectrAlert Advance products shall operate between −40 and 151 degrees Fahrenheit from a regulated DC or full-wave rectified unfiltered power supply. Strobes and horn strobes shall have field-selectable candela settings including 15, 15/75, 30, 75, 95, 110, 115, 135, 150, 177, and 185. Strobe The strobe shall be a System Sensor SpectrAlert Advance Model _______ listed to UL 1971 and shall be approved for fire protective service. The strobe shall be wired as a primary-signaling notification appliance and comply with the Americans with Disabilities Act requirements for visible signaling appliances, flashing at 1 Hz over the strobe’s entire operating voltage range. The strobe light shall consist of a xenon flash tube and associated lens/reflector system. The strobe must be installed with its weatherproof back box in order to remain outdoor approved per UL. The strobe shall be suitable for use in wet environments. Horn Strobe Combination The horn strobe shall be a System Sensor SpectrAlert Advance Model _______ listed to UL 1971 and UL 464 and shall be approved for fire protective service. The horn strobe shall be wired as a primary-signaling notification appliance and comply with the Americans with Disabilities Act requirements for visible signaling appliances, flashing at 1 Hz over the strobe’s entire operating voltage range. The strobe light shall consist of a xenon flash tube and associated lens/reflector system. The horn shall have three audibility options and an option to switch between a temporal three pattern and a non-temporal (continuous) pattern. These options shall be set by a multiple position switch. On four-wire products, the strobe shall be powered independently of the sounder. The horn or horn strobe models shall operate on a coded or non-coded power supply. The horn strobe must be installed with its weatherproof back box in order to remain outdoor approved per UL. The horn strobe shall be suitable for use in wet environments. Physical/Electrical Specifications Operating Temperature –40°F to 151°F (–40°C to 66°C) Strobe Flash Rate 1 flash per second Nominal Voltage Regulated 12 DC/FWR or regulated 24 DC/FWR1 Operating Voltage Range2 8 to 17.5 V (12 V nominal) or 16 to 33 V (24 V nominal) Input Terminal Wire Gauge 12 to 18 AWG Wall-Mount Dimensions (including lens)5.6˝ L × 4.7˝ W × 2.5˝ D (142 mm L × 119 mm W × 64 mm D) Horn Dimensions 5.6˝ L × 4.7˝ W × 1.3˝ D (142 mm L × 119 mm W × 33 mm D) Wall-Mount Weatherproof Back Box Dimensions (SA-WBB)5.7˝ L × 5.1˝ W × 2.0˝ D (145 mm L × 130 mm W × 51 mm D) Notes: 1. Full Wave Rectified (FWR) voltage is a non-regulated, time-varying power source that is used on some power supply and panel outputs. 2. P, S, PC, and SC products will operate at 12 V nominal only for 15 and 15/75 cd. AVDS01201 Horn and Horn Strobe Output (dBA) Switch Position Sound Pattern dB 8–17.5 Volts 16–33 Volts 24-Volt Nominal Reverberant Anechoic DC FWR DC FWR DC FWR DC FWR 1 Temporal High 78 78 84 84 88 88 99 98 2 Temporal Medium 74 74 80 80 86 86 96 96 3 Temporal Low 71 73 76 76 83 80 94 89 4 Non- Temporal High 82 82 88 88 93 92 100 100 5 Non- Temporal Medium 78 78 85 85 90 90 98 98 6 Non- Temporal Low 75 75 81 81 88 84 96 92 7†Coded High 82 82 88 88 93 92 101 101 8†Coded Medium 78 78 85 85 90 90 97 98 9†Coded Low 75 75 81 81 88 85 96 92 †Settings 7, 8, and 9 are not available on 2-wire horn strobe. UL Max. Strobe Current Draw (mA RMS) Candela 8–17.5 Volts 16–33 Volts DC FWR DC FWR Standard Candela Range 15 123 128 66 71 15/75 142 148 77 81 30 NA NA 94 96 75 NA NA 158 153 95 NA NA 181 176 110 NA NA 202 195 115 NA NA 210 205 High Candela Range 135 NA NA 228 207 150 NA NA 246 220 177 NA NA 281 251 185 NA NA 286 258 UL Max. Current Draw (mA RMS), 2-Wire Horn Strobe, Standard Candela Range (15–115 cd) DC Input 8–17.5 Volts 16–33 Volts 15 15/75 15 15/75 30 75 95 110 115 Temporal High 137 147 79 90 107 176 194 212 218 Temporal Medium 132 144 69 80 97 157 182 201 210 Temporal Low 132 143 66 77 93 154 179 198 207 Non-Temporal High 141 152 91 100 116 176 201 221 229 Non-Temporal Medium 133 145 75 85 102 163 187 207 216 Non-Temporal Low 131 144 68 79 96 156 182 201 210 FWR Input Temporal High 136 155 88 97 112 168 190 210 218 Temporal Medium 129 152 78 88 103 160 184 202 206 Temporal Low 129 151 76 86 101 160 184 194 201 Non-Temporal High 142 161 103 112 126 181 203 221 229 Non-Temporal Medium 134 155 85 95 110 166 189 208 216 Non-Temporal Low 132 154 80 90 105 161 184 202 211 UL Max. Current Draw (mA RMS), 2-Wire Horn Strobe, High Candela Range (135–185 cd) DC Input 16–33 Volts FWR Input 16–33 Volts 135 150 177 185 135 150 177 185 Temporal High 245 259 290 297 Temporal High 215 231 258 265 Temporal Medium 235 253 288 297 Temporal Medium 209 224 250 258 Temporal Low 232 251 282 292 Temporal Low 207 221 248 256 Non-Temporal High 255 270 303 309 Non-Temporal High 233 248 275 281 Non-Temporal Medium 242 259 293 299 Non-Temporal Medium 219 232 262 267 Non-Temporal Low 238 254 291 295 Non-Temporal Low 214 229 256 262 UL Max. Horn Current Draw (mA RMS) Sound Pattern dB 8–17.5 Volts 16–33 Volts DC FWR DC FWR Temporal High 57 55 69 75 Temporal Medium 44 49 58 69 Temporal Low 38 44 44 48 Non-Temporal High 57 56 69 75 Non-Temporal Medium 42 50 60 69 Non-Temporal Low 41 44 50 50 Coded High 57 55 69 75 Coded Medium 44 51 56 69 Coded Low 40 46 52 50 UL Current Draw Data Horn Tones and Sound Output DataCandela Derating For K series products used at low temperatures, listed candela ratings must be reduced in accordance with this table. Strobe Output (cd) Listed Candela Candela rating at –40°F 15 Do not use below 32°F15/75 30 75 44 95 70 110 110 115 115 135 135 150 150 177 177 185 185 3825 Ohio Avenue • St. Charles, IL 60174 Phone: 800-SENSOR2 • Fax: 630-377-6495 ©2012 System Sensor. Product specifications subject to change without notice. Visit systemsensor.com for current product information, including the latest version of this data sheet. AVDS01201 • 3/12 SpectrAlert Advance Diagrams Model Description Wall Horn Strobes P2RK*†2-Wire Horn Strobe, Standard cd, Red, Outdoor (includes plastic weatherproof back box) P2RHK*†2-Wire Horn Strobe, High cd, Red, Outdoor (includes plastic weatherproof back box) P2WK*†2-Wire Horn Strobe, Standard cd, White, Outdoor (includes plastic weatherproof back box) P2WHK*†2-Wire Horn Strobe, High cd, White, Outdoor (includes plastic weatherproof back box) P4RK†4-Wire Horn Strobe, Standard cd, Red, Outdoor (includes plastic weatherproof back box) P4WK 4-Wire Horn Strobe, Standard cd, White, Outdoor (includes plastic weatherproof back box) P2RHK-120 2-Wire Horn Strobe, High cd, Red, Outdoor, 120 V (includes plastic weatherproof back box) Wall Strobes SRK*†Strobe, Standard cd, Red, Outdoor (includes plastic weatherproof back box) SRHK*†Strobe, High cd, Red, Outdoor (includes plastic weatherproof back box) SWK*†Strobe, Standard cd, White, Outdoor (includes plastic weatherproof back box) SWHK*†Strobe, High cd, White, Outdoor (includes plastic weatherproof back box) Horns HRK†Horn, Red, Outdoor (includes plastic weatherproof back box) Accessories SA-WBB Red, Metal Weatherproof Back Box SA-WBBW White, Metal Weatherproof Back Box SpectrAlert Advance Ordering Information Notes: * Add “-P” to model number for plain housing (no “FIRE” marking on cover), e.g., P2RK-P. † Add “-R” to model number for weatherproof replacement device (no back box included), only for use with weatherproof outdoor flush mounting plate, WTP and WTPW. “Standard cd” refers to strobes that include 15, 15/75, 30, 75, 95, 110, and 115 candela settings. “High cd” refers to strobes that include 135, 150, 177, and 185 candela settings. When replacing standard outdoor units both the device and back box must be replaced. 4.7˝ 5.6˝ 6.8˝ Dia. 2.5˝ 2.5˝ Wall-Mount Horn Strobes Wall Plastic Weatherproof Back Box Wall-Mount Horn Strobe with Plastic Weatherproof Back Box AVDS910-01 • 10/1/2019 • Page 1 Horns only: 7135-1653:0516 Horn/Strobes: 7125-1653:0517 PR452768 S4011 Features • 520 Hz ± 10% square wave tone, NFPA compliance • Full candela range plus High/Low tone options to optimize current draw for a wide variety of applications • Compact, standard, and round ceiling options • Field-selectable candela settings on wall units: 15, 30, 75, 95, 110, 135, and 185 • Rotary switch for High and Low, Temp3 and Temp4 settings • Plug-in design with minimal intrusion into the back box • Mounting plate shorting spring checks wiring continuity before device installation • Electrically compatible with legacy SpectrAlert and SpectrAlert Advance devices (Direct replacement for HW/R-LF and P2R/WH-LF) • Compatible with MDL3 sync module • Sounders listed for ceiling and wall mounting • Sounder Strobe listed for wall mounting • Updated modern aesthetics The L-Series offers the most versatile and easy-to-use line of low frequency sounder and low frequency sounder strobes in the industry. With white and red plastic housings, listed for wall and ceiling mounting, L-Series Low Frequency can meet virtually any application requirement. The low frequency sounder and low frequency sounder strobes were designed to address the NFPA 72 sleeping space requirements that require a low frequency notification appliance that operates within frequency range of 520 Hz ± 10% and is of a square wave tone. Like the entire L-Series product line they include a variety of features that increase their application versatility while simplifying installation. All devices feature plug-in designs with minimal intrusion into the back box, making installations fast and foolproof while virtually eliminating costly and time-consuming ground faults. To further simplify installation and protect devices from construction damage, L-Series uses a universal mounting plate with an onboard shorting spring, so installers can test wiring continuity before the device is installed. Installers can also easily adapt devices to a suit a wide range of application requirements using field-selectable candela settings, 24- volt operation, and a rotary switch for 520 Hz low frequency sounder tones. Indoor Selectable- Output Low Frequency Sounders and Low Frequency Sounder Strobes System Sensor L-Series audible visible notification products are rich with features guaranteed to maximize profits with lower current draw and modern aesthetics. Agency Listings AVDS910-01 • 10/1/2019 • Page 2 L-Series Specifications Architect/Engineer Specifications General L-Series low frequency sounder and low frequency sounder strobes shall mount to a standard 4 × 4 × 1½-inch back box, 4-inch octagon back box, or double-gang back box. Two-wire products shall also mount to a single-gang 2 × 4 × 17⁄8-inch back box. A universal mounting plate shall be used for mounting products. The notification appliance circuit wiring shall terminate at the universal mounting plate. Also, L-Series products, when used with the Sync•Circuit™ Module accessory, shall be powered from a non-coded notification appliance circuit output and shall operate on a nominal 12 or 24 volts. When used with the Sync•Circuit Module, 24-volt-rated notification appliance circuit outputs shall operate between 16.5 and 33 volts. Indoor L-Series products shall operate between 32 and 120 degrees Fahrenheit (0°C to 49°C) from a regulated DC or full-wave rectified unfiltered power supply. Low Frequency Sounder strobes shall have field-selectable candela settings including 15, 30, 75, 95, 110, 135, 185. The field selectable tones will sound within the frequency range of 520 Hz ±10% square wave tone and have a permanent marking on the housing that reads “low frequency sounder”. Low Frequency Sounder The low frequency sounder shall be a System Sensor L-Series Model _______ listed to UL 464 and shall be approved for fire protective service. The low frequency sounder and the Sync•Circuit™ MDL3 Module accessory, if used, shall be powered from a notification appliance circuit output and shall operate on a nominal 24 volts (includes fire alarm panels with built-in sync). When used with the Sync•Circuit Module MDL3, 24-volt rated notification appliance circuit outputs shall operate between 16.5 to 33 volts. If the notification appliances are not UL 9th edition listed with the corresponding panel or power supply being used, then refer to the compatibility listing of the panel to determine maximum devices on a circuit. The low frequency sounder has an option to switch between temporal three or temporal four pattern, non- temporal (continuous) pattern and coded supply within the frequency range of 520Hz ± 10% square wave tone. The low frequency sounder shall operate on a coded or non-coded power supply with high and low volume settings. Low Frequency Sounder Strobe Combination The low frequency sounder strobe shall be a System Sensor L-Series Model _______ listed to UL 1971 and UL 464 and shall be approved for fire protective service. The low frequency sounder strobe shall be wired as a primary-signaling notification appliance and comply with the Americans with Disabilities Act requirements for visible signaling appliances, flashing at 1 Hz over the strobe’s entire operating voltage range. The strobe light shall consist of a xenon flash tube and associated lens/reflector system. The sounder shall have an option to switch between a temporal three or temporal four pattern and a non-temporal (continuous) pattern. These options are set by a multiple position switch. The low frequency sounder on low frequency sounder strobe models shall operate on a non-coded power supply with high and low volume settings. The field selectable tones will sound within the frequency range of 520 Hz ±10% square wave tone. Synchronization Module The module shall be a System Sensor Sync•Circuit model MDL3 listed to UL 464 and shall be approved for fire protective service. The module shall synchronize SpectrAlert strobes at 1 Hz and low frequency sounder at temporal three. Also, while operating the strobes, the module shall silence the low frequency sounder on low frequency sounder strobe models over a single pair of wires. The module shall mount to a 411 ⁄16 × 411 ⁄16 × 21⁄8-inch back box. The module shall also control two Class B circuits or one Class A circuit. The module shall synchronize multiple zones. Daisy chaining two or more synchronization modules together will synchronize all the zones they control. The module shall not operate on a coded power supply. Physical/Electrical Specifications Standard Operating Temperature 32°F to 120°F (0°C to 49°C) Humidity Range 10 to 93% non-condensing Frequency Range 520 Hz ± 10% Strobe Flash Rate 1 flash per second Nominal Voltage Low Frequency Sounder Regulated 24 DC/FWR1 Nominal Voltage Range Low Frequency Sounder Strobe Regulated 24 VDC/FWR1 Operating Voltage Range 16 to 33 V (24 V nominal) Operating Voltage Range MDL3 Sync Module 16.5 to 33 V (24 V nominal) Input Terminal Wire Gauge 12 to 18 AWG Dimensions Wall Sounder Strobe (including lens)5.6" L x 4.7" W x 1.9" D (142 mm L x 119 mm W x 49 mm D) Standard Wall Sounder 5.6" L × 4.7" W × 1.5" D (142 mm L × 119 mm W × 38 mm D) Compact Wall Sounder 5.25" L x 3.46" W x 1.5" D (133mm L x 88mm W x 38mm D) Ceiling Sounder 6.8" diameter x 1.4" high (173mm diameter x 36mm high) Standard Wall Sounder with SBBRL/SBBWL Surface Mount Back Box 5.7” L x 4.8” W x 3.3” D (145 mm L x 120 mm W x 87 mm D) Compact Wall Sounder with SBBGRL/SBBGWL Surface Mount Back Box 5.4” L x 3.6” W x 3.0” D (137 mmL x 91mm W x 76 mm D) Low Frequency Ceiling Sounder with SBBCRL/SBBCWL Surface Mount Back Box 6.9" diameter x 3.9" high (175mm diameter x 99mm high) Notes: 1. Full Wave Rectified (FWR) voltage is a non-regulated, time-varying power source that is used on some power supply and panel outputs. AVDS910-01 • 10/1/2019 • Page 3 UL Current Draw and Sound Output Data Low Frequency Wall Sounder Strobe Current Draw (mA) and Sound Output (dBA) Current Draw (mA) Sound Output (dBA) Pos Tone Volume Setting 16-33 VDC 16-33 FWR 16-33 V 15cd 30cd 75cd 95cd 110cd 135cd 185cd 15cd 30cd 75cd 95cd 110cd 135cd 185cd DC FWR 1 Temporal 3 High 98 115 158 173 182 212 266 136 153 188 206 228 258 304 80 80 2 Temporal 3 Low 98 102 141 162 173 202 255 150 150 176 194 216 242 280 76 76 3 Temporal 4 High 98 108 137 151 178 202 252 200 198 169 188 212 242 290 80 80 4 Temporal 4 Low 102 104 122 136 163 187 237 176 174 154 173 197 227 275 76 76 5 Continuous High 141 158 198 216 234 264 305 190 207 249 268 289 321 368 80 80 6 Continuous Low 120 128 179 196 215 244 285 165 182 226 244 266 297 342 76 76 UL Max. Low Frequency Sounder Current Draw (mA RMS) Volume Setting Current Draw (mA) Sound Output (dBA) Reverberant 16–33 Volts 16–33 Volts Pos Tone DC FWR DC FWR 1 Temporal 3 High 108 150 80 80 2 Temporal 3 Low 78 76 76 76 3 Temporal 4 High 111 151 80 80 4 Temporal 4 Low 80 76 76 76 5 Continuous High 111 151 80 80 6 Continuous Low 80 76 76 76 7 Coded High 111 151 80 80 8 Coded Low 80 76 76 76 *NOTE: For coded tones, temporal coding must be provided by the NAC. If the NAC voltage is held constant, the sounder output will remain constantly on. Coded ratings provided are for continuous voltage. 3825 Ohio Avenue • St. Charles, IL 60174 Phone: 800-SENSOR2 • Fax: 630-377-6495 ©2019 System Sensor. Product specifications subject to change without notice. Visit systemsensor.com for current product information, including the latest version of this data sheet. AVDS910-01 • 10/1/2019 Part No.Description Red White Low Frequency Sounder Strobes P2RL-LF P2WL-LF LF Sounder Strobe, Wall Low Frequency Sounders HRL-LF HWL-LF LF Sounder, Wall HGRL-LF HGWL-LF Compact LF Sounder, Wall HCRL-LF HCWL-LF LF Sounder, Ceiling Accessories MDL3R MDL3W Sync•Circuit™ Module, UL-listed SBBRL SBBWL Surface Mount Back Box, Wall SBBCRL SBBCWL Surface Mount Back Box, Ceiling SBBGRL SBBGWL Surface Mount Back Box, Wall, Compact L-Series Dimensions Wall LF Sounder Strobe Wall LF Sounder Compact Wall LF Sounder 3.455 1.453 5.265 Ceiling LF Sounder 6.830 1.438 System Sensor® is a registered trademark and Sync•Circuit™ is a trademark of Honeywell International, Inc. 4.700 1.453 5.670 www.edwardssignaling.com 1-91TM VISUAL SIGNALS1 Ordering Information Description Cat. No.Operating Voltage1 Current LED Colors Lamp Ratings Replacement Lens Flashing Beacon LED Gray Base 125LEDFA120A 120V AC 0.097 A Amber 100,000 hours 125LA 125LEDFB120A 120V AC 0.097 A Blue 100,000 hours 125LB 125LEDFG120A 120V AC 0.097 A Green 100,000 hours 125LG 125LEDFR120A 120V AC 0.097 A Red 100,000 hours 125LR 125LEDFA24D 24V DC 0.060 A Amber 100,000 hours 125LA 125LEDFB24D 24V DC 0.060 A Blue 100,000 hours 125LB 125LEDFG24D 24V DC 0.060 A Green 100,000 hours 125LG 125LEDFR24D 24V DC 0.060 A Red 100,000 hours 125LR Flashing Beacon LED Black Base 125LEDFA120AB 120V AC 0.097 A Amber 100,000 hours 125LA 125LEDFB120AB 120V AC 0.097 A Blue 100,000 hours 125LB 125LEDFG120AB 120V AC 0.097 A Green 100,000 hours 125LG 125LEDFR120AB 120V AC 0.097 A Red 100,000 hours 125LR 125LEDFA24DB 24V DC 0.060 A Amber 100,000 hours 125LA 125LEDFB24DB 24V DC 0.060 A Blue 100,000 hours 125LB 125LEDFG24DB 24V DC 0.060 A Green 100,000 hours 125LG 125LEDFR24DB 24V DC 0.060 A Red 100,000 hours 125LR 1AC voltage frequency is 50/60 Hz Edwards 125 Class standard flashing LED beacons are NEMA Type 4X signaling devices, suitable for use in indoor or outdoor applications where an intermittent (flashing) light source is required. Base material is gray or black, manufactured from a 33% glass filled nylon, providing a high resistance to heat and chemicals. The lens is made of shatter-resistant polycarbonate. Features and Specifications •LED light source •Flash rate 65 fpm •Shatter-resistant polycarbonate lens •Gray or black glass filled nylon base •Option for panel or conduit mounting •Suitable for indoor or outdoor applications •For outdoor use, lens should face up •NEMA Type 4X enclosure •Operating temperature range: -31°F to 150°F (-35°C to 66°C) Beacons Flashing LED 125 Class 150°F -31°F OP TEMPAC ENCLOSURE 4X DC Accessories Description Cat. No. Protective Wire Guard 125GRD Corner Mount Bracket CBR Wall Mount Bracket WBR LED 3.25" R A G B New Product CBR Corner Mount Bracket WBR Wall Mount Bracket 125GRD Protective Wire Guard www.edwardssignaling.com1-92 TMVISUAL SIGNALS1 Gasket (provided for use when direct panel mounting) Locknut - 1.3625" O.D. (provided for use when direct panel mounting) 3.25"(82.6mm) 3.875"(98.4mm) Double threaded forpanel mounting or1/2" internal or 3/4" externalconduit mounting Beacons Flashing LED 125 Class Weights and Dimensions Cat. No. Approx. Net Weight (lb.) Approx. Shipping Weight (lb.) 125LEDF*120A 0.25 0.50 125LEDF*24D 0.25 0.50 125LEDF*120AB 0.25 0.50 125LEDF*24DB 0.25 0.50 125GRD 0.61 0.77 CBR 4.00 4.20 WBR 2.30 2.50 *Letter in this position designates LED color: A - amber, B - blue, G - green, R - red POLYCARBONATE PRODUCTS For more information, call 1-800-888-4784 (4STI) or visit www.sti-usa.com KEY FEATURES General Information · Protects against vandalism, accidental damage, dust and grime and severe environments inside and outside. · Protects pull stations, keypads, intercom stations, emergency buttons, electrical light switches or duplex plugs. · ADA Compliant. · Three year guarantee against breakage of polycarbonate in normal use (one year on electro mechanical and electronic components). Design · Top and bottom of waterproof back box are threaded for 3/4” NPT rigid conduit. · Sized to fit most pull stations. · High strength continuous hinge. Construction · Cover is molded from thick, tough polycarbonate material. · UV-stabilized to keep cover clear. Installation · Gaskets included. · Typical working properties of polycarbonate are -40° to 250°F (-40° to 121°C). Electronics · Dome models have optional relay output with 12-24 VDC power input. · Dome models available with or without 105 dB horn. Options · Cover available in low profile or dome shape. · Flush frame, surface frame or waterproof back box (with sealed or open internal mounting plate), enclosed flush back box. · Locking tab (not for use with fire pull stations). · Dome models available with red, green, blue, yellow, white or black label hood/horn housing with custom or no label. · Available for red units “In Case of Fire…” label. STI UNIVERSAL STOPPER ® PRODUCT OVERVIEw These indoor/outdoor low profile or dome polycarbonate covers protect devices such as dual action pull stations, keypads for entry systems, intercom stations, emergency buttons, electrical light switches, duplex plugs, etc., without restricting legitimate operation. The versatile cover offers excellent protection against physical damage (both accidental and intentional), dust and grime as well as severe environments inside and out. Cover options: Dome or Low Profile, with or without horn, flush mount, surface mount or waterproof back box models. Maximum protrusion is 4 inches deep. Cover has the same footprint as the Mini Stopper® but accommodates most dual action pull stations. Indoor/Out d o o r Shown with waterproof back box See Reverse For Details ADACompliant ADACompliant Equipment Panel/Dedicated Circuit Surge Protective Device General Product Specifications DTK-HW Series DTK-120HW DTK-120/240HW Product Features • Diagnostic LED indicates ground presence, system power and SPD function • Weatherproof enclosure • Small footprint enables installation in a variety of locations • Available for popular 120V, and 120/240V systems • Ten Year Limited Warranty One DITEK Center 1720 Starkey Road Largo, FL 33771 1-800-753-2345 Technical Support: 1-888-472-6100 www.ditekcorp.com Document: SPS-100057-001 Rev 8 05-11 ©2011 DITEK Corp. Specification Subject to Change Specifications Agency Approvals: UL 1449, 3rd Edition, cUL IEEE Location Category: Category B Protector Type: SPD Type 2 Protection Modes: L-G, L-N, N-G Response Time: <1ns Temperature Range:-40°F – 185°F (-40°C – 85°C) Maximum Humidity: 95% non-condensing Operating Frequency: 0Hz – 400Hz Dimensions: 2.93” x 2.83” x 1.68” (74.4mm x 71.9mm x 42.7mm) Connection: ¾” diameter threaded fitting Weight: .5lb. (227g) Housing: ABS DITEK’s HW series of surge protectors are designed and manufactured to meet the exacting standards of the life safety industry. These compact parallel mount surge protectors are widely used to protect fire alarm panels and other dedicated branch circuit loads. 3,000A10,000A700V L-N, L-G; 600V N-G130V19,500ASingle Φ (2W + G), 120VAC120HW 3,000A10,000A 700V L-N, L-G; 600V N-G; 1200V L-L 130/260V 13,000A/ Phase 6,500A/ Mode Split Φ (3W + G), 120/240VAC120/240HW MCOV UL1449, 3rd Ed. InRating UL 1449, 3rd Ed. V.P.R. Short Circuit Current Rating Peak Surge Current Service Wiring Model Selection: DTK- Every precaution has been taken to ensure that this literature is accurate and complete. DITEK Corporation assumes no responsibility and disclaims all liability for damages resulting from the use of this information or for any errors or omissions. One DITEK Center 1720 Starkey Road - Largo, FL 33771 Phone: 1-800-753-2345 Direct: 727-812-5000 Technical Support: 1-888-472-6100 www.ditekcorp.com Doc. Number: SPS-100011-001 Rev 7 01/15 ©2015 DITEK Corp. Page 1 of 1 Technical Specifications Part Numbers: DTK-2MHTP DTK-2MHTPWB Service Voltage: Ring up voltage 110V MCOV: 130V Clamping Voltage: 200V Protection Modes: Line-Ground (All) Surge Current Rating: 14,000 Amps (8/20µS wave form) Max Continuous Current: 150mA Mechanical Characteristics Base Connection Method: 10AWG max screw terminal Module Connection Method: Edge card into mounting base Housing: ABS Operating Temperature: -40°F - 158°F (-40°C - 70°C) Maximum Humidity: 95% non-condensing Dimensions: Module 2.1”L x 1.5”W x 1.9”H (53mm x 36mm x 48mm) Module with Base 3.25”L x 1.5”W x 2.6”D (83mm x 38mm x 66mm) Weight: 1.2 oz (34g) 2.8 oz (79g) Quality, Standards & Approval Agency Approvals: UL497A Warranty: Ten Year Limited Warranty DITEK’s DTK-2MHTP dialer surge protectors provide robust protection in a compact package. This series was designed for ease of installation, with convenient field- replaceable modules and a Snap-Track base system, allowing the installer to protect multiple circuits terminating at the same grounding point. Applications  Fire Alarm Dialer Circuits  Burglar Alarm Dialer Circuits Accessories  Test Module Kit – Part Number DTK-2MHLPTM  DIN Rail Mounting Kit – Part Number DTK-DRK DTK-2MHTPWB Product Features  Protects two dialer circuits per module  Hybrid design delivers high surge current capacity and reliable voltage clamping for peak protection  Field replaceable, hot swappable, modular edge card connection design with a single point ground for fast installation, saves time  Hard-wired multi-base mounting system allows you to protect up to ten pairs with a common ground. See DTK-2MHLP datasheet for more information about multi-base options PS SERIESTERMINALS: (mm) DIMENSIONS: inch (mm)PERFORMANCE SPECIFICATIONS Nominal Voltage 12 volts (6 cells) Nominal Capacity 20-hr. (350mA to 10.50 volts) 10-hr. (650mA to 10.50 volts) 5-hr. (1.2A to 10.20 volts) 1-hr. (4.5A to 9.00 volts) 7.00 AH 6.50 AH 6.00 AH 4.50 AH Approximate Weight 4.80 lbs. (2.18 kg) Internal Resistance (approx.) 23.0 milliohms Max Short-Duration Discharge Current (10 Sec.)70.0 amperes Shelf Life (% of nominal capacity at 68°F (20°C) 1 Month 3 Month 6 Month 97% 91% 83% Operating Temperature Range Charge Discharge 5°F (-15°C) to 122°F (50°C) -4°F (-20°C) to 140°F (60°C) Case ABS Plastic Power Sonic Chargers PSC-12800A-C PSC-121000-PC www.power-sonic.com To ensure safe and efficient operation always refer to the latest edition of our Technical Manual, as published on our website. © 2018. Power-Sonic Corporation. All rights reserved. All trademarks are the property of their respective owners. All data subject to change without notice. E&O.E CORPORATE HEADQUARTERS (USA AND INTERNATIONAL EXCLUDING EMEA) Power-Sonic Corporation 7550 Panasonic Way, San Diego, California 92154 T: +1 (619) 661 2020 F: +1 (619) 661 3650 E: customer-service@power-sonic.com POWER-SONIC EUROPE LIMITED (EMEA – EUROPE, MIDDLE EAST AND AFRICA) 3 Buckingham Square, Hurricane Way, Wickford, Essex SS11 8YQ T: +44 (0)1268 560686 F: +44 (0)1268 560902 E: salesEMEA@power-sonic.com General Purpose Fire & SecurityEmergency Lighting MO DE L PS -1270 F1 12 Volt 7.0 Amp. Hr. Warning: Risk of fire, explosion, or burns.Do not disassemble, heat above 60 C, or incinerate. Rechargeable Sealed Lead-Acid BatteryDC power, constant voltage chargeCycle use: 14.4 - 15.0V(20 C)Standby use: 13.5 - 13.8V(20 C)Initial current: 2.1A MAX 801334001000Sealed R echargeable Battery 120070260211 L HT H W Tolerances are +/- 0.04 in. (+/- 1mm) and +/- 0.08 in. (+/- 2mm) for height dimensions. All data subject to change without notice. L: 5.95 (151) W: 2.56 (65) H: 3.70 (94) HT: 3.86 (98) L: 5.95 (151) W: 2.56 (65) H: 3.70 (94) HT: 3.86 (98) Tolerances are +/- 0.04 in. (+/- 1mm) and +/- 0.08 in. (+/- 2mm) for height dimensions. All data subject to change without notice. FEATURES •Absorbent Glass Mat (AGM) technology for superior performance •Valve regulated, maintenance free spill proof construction •Power/volume ratio yielding excellent energy density •Rugged vibration and impact resistant ABS case and cover •Gas recombination technology •5 year design life APPROVALS •Approved for transport by air. D.O.T., I.A.T.A., F.A.A. and C.A.B. certifi ed •U.L. recognized •ISO9001:2015 – Quality management systems Medical Rev1: 11/18PS-1270 12V 7.0 AH @ 20-hr.12V 6.5 AH @ 10-hr. Rechargeable Sealed Lead Acid Battery PS – General Purpose Series OR Torque – Not Applicable 4.751.56.35 3.2 2.5 0.8F1: Quick disconnect tabs, 0.187" x 0.032" – Mate with AMP. INC. FASTON “187” series Torque – Not Applicable 6.351.57.95 3.4 2.5 0.8F2: Quick disconnect tabs, 0.250" x 0.032" – Mate with AMP. INC FASTON “250” series PS SERIESwww.power-sonic.com To ensure safe and efficient operation always refer to the latest edition of our Technical Manual, as published on our website. © 2018. Power-Sonic Corporation. All rights reserved. All trademarks are the property of their respective owners. All data subject to change without notice. E&O.E CORPORATE HEADQUARTERS (USA AND INTERNATIONAL EXCLUDING EMEA) Power-Sonic Corporation 7550 Panasonic Way, San Diego, California 92154 T: +1 (619) 661 2020 F: +1 (619) 661 3650 E: customer-service@power-sonic.com POWER-SONIC EUROPE LIMITED (EMEA – EUROPE, MIDDLE EAST AND AFRICA) 3 Buckingham Square, Hurricane Way, Wickford, Essex SS11 8YQ T: +44 (0)1268 560686 F: +44 (0)1268 560902 E: salesEMEA@power-sonic.com SHELF LIFE & STORAGE LIFE CHARACTERISTICS IN STAND-BY USE Capacity Retention Ratio (%)Standing Period (Months) 100 80 60 40 00 2 4 6 8 10 12 14 16 18 20 40oC (104oF) 30oC (86oF)20oC (68oF) 5oC (41oF) Charging is not necessary unless 100% of capacity is required. Charging beforeuse is necessaryto help recoverfull capacity. 100 80 60 40 20 0 012345 Ambient Temperature 20˚C (68˚F) Float Charging Voltage 2.25 - 2.30 V/Cell Retention Capacity (%)Years SHELF LIFE & STORAGE LIFE CHARACTERISTICS IN STAND-BY USE Capacity Retention Ratio (%)Standing Period (Months) 100 80 60 40 00 2 4 6 8 10 12 14 16 18 20 40oC (104oF) 30oC (86oF)20oC (68oF) 5oC (41oF) Charging is not necessary unless 100% of capacity is required. Charging beforeuse is necessaryto help recoverfull capacity. 100 80 60 40 20 0 012345 Ambient Temperature 20˚C (68˚F) Float Charging Voltage 2.25 - 2.30 V/Cell Retention Capacity (%)Years SHELF LIFE & STORAGE LIFE CHARACTERISTICS IN STAND-BY USE CHARGING Cycle Applications: Apply constant voltage charge at 2.35v/c – 2.45v/c (14.1 – 14.7v for 12v Monobloc) at 20°C. Initial charging current should be set at less than 0.25C Amps. Switch to fl oat charge to avoid overcharging. “Float” or “Stand-By” Service: Apply constant voltage charge of 2.25v/c – 2.30v/c (13.5 to 13.8 volts for 12v Monobloc at 20°C. When held at this voltage, the battery will seek its own current level and maintain itself in a fully charged condition. Temperature Compensation: Charging Voltage for both Cyclic and Standby applications should be regulated in relation to ambient temperature. As temperature rises charging voltage should be reduced to prevent overcharge and increased as temperature falls to avoid undercharge. For further charging information including temperature compensation factors, see Power Sonic Technical Manual/ Power Sonic Charger specifi cations. CHARGERS Power Sonic offers a wide range of chargers suitable for batteries with a variety of capacities. Please refer to our website for more information on our switch mode and transformer type chargers. Please contact our technical department for advice if you have diffi culty in locating a suitable charger. FURTHER INFORMATION Please refer to our website www.power-sonic.com for a complete range of useful downloads, such as product catalogs, material safety data sheets (MSDS), ISO certifi cation, etc. APPLICATIONS •General purpose •Emergency lighting •Medical •Fire and security PS-1270 12V 7.0 AH @ 20-hr.12V 6.5 AH @ 10-hr. Rechargeable Sealed Lead Acid Battery PS – General Purpose Series Rev1: 11/18 Published: 2018-10-19 Riser Rated Power Limited Fire Alarm Cable Part Number: 4306 18 AWG 2 Solid Conductors Ratings FPLR, CL3R, FT4, Sunlight Resistant Approvals UL Listed Construction Conductor 18 AWG Solid Bare Copper Conductor Count 2 Insulation Polypropylene (0.006" nom.) Insulation Colors Black, Red Lay Length 2.00" nom. Shielding N/A Rip Cord Yes Jacket PVC (0.015 " nom.) Overall Diameter 0.144" nom. Print Legend GENESIS P/N 4306 2C 18AWG E175105 (UL) FPLR OR CL3R FT4 SUN RES 75C (RoHS) W/O# XXXXXX-XXXXXXX XXXXFT A B C D E F 1 2 3 4 5 6 7 8 9 Properties Operating Voltage 300 Volts max. DC Resistance 6.52 Ohms/1000' at 20°C Capacitance 22.8 pF/ft. nom. Impedance 66 Ohms nom. Temperature -20°C to 75°C Flame Rating UL 1666 (Riser); CSA C22.2 No. 2556 (FT4) RoHS Compliant Yes Country of Origin USA Published: 2018-10-19 Riser Rated Power Limited Fire Alarm Cable Part Number: 4307 18 AWG 4 Solid Conductors Ratings FPLR, CL3R, FT4, Sunlight Resistant Approvals UL Listed Construction Conductor 18 AWG Solid Bare Copper Conductor Count 4 Insulation Polypropylene (0.006" nom.) Insulation Colors Black, Red, Green, Yellow Lay Length 6.00" nom. Shielding N/A Rip Cord Yes Jacket PVC (0.015 " nom.) Overall Diameter 0.159" nom. Print Legend GENESIS P/N 4307 4C 18AWG E175105 (UL) FPLR OR CL3R FT4 SUN RES 75C (RoHS) W/O# XXXXXX-XXXXXXX XXXXFT A B C D E F 1 2 3 4 5 6 7 8 9 Properties Operating Voltage 300 Volts max. DC Resistance 6.52 Ohms/1000' at 20°C Capacitance 22.8 pF/ft. nom. Impedance 66 Ohms nom. Temperature -20°C to 75°C Flame Rating UL 1666 (Riser); CSA C22.2 No. 2556 (FT4) RoHS Compliant Yes Country of Origin USA Published: 2018-10-19 Riser Rated Power Limited Fire Alarm Cable Part Number: 4313 14 AWG 2 Solid Conductors Ratings FPLR, CL3R, FT4, Sunlight Resistant Approvals UL Listed Construction Conductor 14 AWG Solid Bare Copper Conductor Count 2 Insulation Polypropylene (0.008" nom.) Insulation Colors Black, Red Lay Length 5.25" nom. Shielding N/A Rip Cord Yes Jacket PVC (0.015 " nom.) Overall Diameter 0.196" nom. Print Legend GENESIS P/N 4313 2C 14AWG E175105 (UL) FPLR OR CL3R FT4 SUN RES 75C (RoHS) W/O# XXXXXX-XXXXXXX XXXXFT A B C D E F 1 2 3 4 5 6 7 8 9 Properties Operating Voltage 300 Volts max. DC Resistance 2.57 Ohms/1000' at 20°C Capacitance 24.1 pF/ft. nom. Impedance 63 Ohms nom. Temperature -20°C to 75°C Flame Rating UL 1666 (Riser); CSA C22.2 No. 2556 (FT4) RoHS Compliant Yes Country of Origin USA SECTION III BATTERY CALCULATIONS VOLTAGE DROPS Device Type Qty Total Qty Total 6808 Control Panel 1 x 0.190000 = 0.190000 1 x 0.250000 = 0.250000 SK-PHOTO (-T)x 0.000300 =x 0.000300 = SK-PHOTO-W (-T) 61 x 0.000200 = 0.012200 61 x 0.000450 = 0.027450 SK-HEAT(-HT) (-ROR) 3 x 0.000300 = 0.000900 3 x 0.000300 = 0.000900 SK-HEAT-W(HT) (ROR)x 0.000200 =x 0.000450 = SK-BEAM 2 x 0.002000 = 0.004000 2 x 0.002000 = 0.004000 SK-BEAM-T x 0.002000 =x 0.002000 = SK-DUCT x 0.000300 =x 0.000300 = SK-ACCLIMATE x 0.000300 =x 0.000300 = SK-CONTROL x 0.000375 =x 0.000375 = SK-MONITOR 1 x 0.000375 = 0.000375 1 x 0.000375 = 0.000375 SK-MINIMON 8 x 0.000375 = 0.003000 8 x 0.000375 = 0.003000 SK-PULL-SA x 0.000375 =x 0.000375 = SK-PULL-DA 13 x 0.000375 = 0.004875 13 x 0.000375 = 0.004875 SK-MONITOR-2 6 x 0.000750 = 0.004500 6 x 0.000750 = 0.004500 SK-MON-10 x 0.003500 =x 0.003500 = SK-RELAY-6 x 0.001450 =x 0.001450 = SK-CONTROL-6 x 0.002250 =x 0.002250 = SK-RELAY 13 x 0.000255 = 0.003315 13 x 0.000255 = 0.003315 SK-RELAYMON-2 x 0.001300 =x 0.024000 = SK-ZONE x 0.000270 =x 0.000270 = SK-ZONE-6 x 0.002000 =x 0.002000 = SK-FIRE-CO x 0.000300 =x 0.007200 = B200S x 0.000300 =x 0.000300 = B200S-LF x 0.000300 =x 0.000300 = B200SR x 0.000300 =x 0.000300 = B200SR-LF x 0.000300 =x 0.000300 = B224RB x 0.000500 =x 0.000500 = RTS151 x 0.000000 =x 0.007500 = RTS151KEY 2 x 0.000000 = 0.000000 2 x 0.007500 = 0.015000 RA100Z 8 x 0.000000 = 0.000000 8 x 0.010000 = 0.080000 SK-ISO x 0.000450 =x 0.000450 = ISO-6 x 0.002700 =x 0.102000 = B224BI 5 x 0.000500 = 0.002500 5 x 0.000500 = 0.002500 SK-CONTROL (Aux. Power)x 0.001700 =x 0.007000 = SK-CONTROL-6 (Aux. Power)x 0.008000 =x 0.020000 = SK-ZONE (Aux. Power)x 0.012000 =x 0.090000 = SK-ZONE-6 (Aux. Power)x 0.050000 =x 0.270000 = B200S (Aux. Power)x 0.000500 =x 0.035000 = B200S-LF (Aux. Power)x 0.000550 =x 0.140000 = B200SR (Aux. Power)x 0.000500 =x 0.035000 = B200SR-LF (Aux. Power)x 0.001000 =x 0.125000 = 1. Control Panel 2. Addressable SLC Devices 3. SLC Accessory Bases 4. SLC Isolator Devices 5. Auxiliary Power Draw - SLC Devices IntelliKnight 6808 Battery Calculation Secondary Power Source Requirements Standby Current (amps) Secondary Alarm Current (amps) Current Draw Current Draw Page 1 5/30/2020Honeywell Internal 5860 x 0.020000 =x 0.025000 = 5824 x 0.045000 =x 0.045000 = 5496 x 0.010000 =x 0.010000 = 5895XL x 0.010000 =x 0.010000 = 6855 x 0.020000 =x 0.025000 = 6860 x 0.025000 =x 0.050000 = 5865-4 x 0.035000 =x 0.145000 = 5865-3 x 0.035000 =x 0.145000 = 5880 x 0.035000 =x 0.200000 = 5883 x 0.000000 =x 0.220000 = SK-IP-2 x 0.093000 =x 0.136000 = SK-IP-2UD x 0.098000 =x 0.155000 = CELL-MOD x 0.055000 =x 0.100000 = CELL-CAB-SK x 0.055000 =x 0.100000 = WSK-WGI Aux. Power x 0.040000 =x 0.040000 = SLC Power x 0.024000 =x 0.024000 = SK-NIC x 0.021000 =x 0.021000 = SK-NIC-KIT x 0.021000 =x 0.021000 = SK-FSL x 0.079000 =x 0.079000 = SK-FML x 0.053000 =x 0.053000 = SK-FFT x 0.120000 =x 0.230000 = Miscellaneous Device 3 x 0.000000 =x 0.000000 = Miscellaneous Device 4 x 0.000000 =x 0.000000 = Miscellaneous Device 5 x 0.000000 =x 0.000000 = NAC 1 0.000000 = 0.791000 = 0.791000 NAC 2 0.000000 = 0.848000 = 0.848000 NAC 3 0.000000 = 0.060000 = 0.060000 NAC 4 0.000000 = 0.848000 = 0.848000 0.225665 2.942915 6. Accessory Modules 8. Notification Appliance Circuits Total Standby Load Total Alarm Load Page 2 5/30/2020Honeywell Internal Note 2: Use the dropdowns in the yellow cells to enter values. x = 5.416 AH x = 0.247 AH 5.663 AH = x 1.20 6.80 AH Circuit#1 current is within the limitations of the circuit. Circuit#2 current is within the limitations of the circuit. Circuit#3 current is within the limitations of the circuit. Circuit#4 current is within the limitations of the circuit. 6808 Control Panel: The output current is within the panel's limitations. Battery Check The batteries can be charged by the 6808 Charger. The batteries can be housed in the 6808 Cabinet. Current Draw Check Total Current Load Multiply by the Derating Factor 1.2 Total Ampere Hours Required Recommended Batteries: BAT-1270 - 7AH Batteries Required Alarm Time in Minutes 5 Minutes Alarm Load Current (Amps) 2.94292 Amps 0.084 Calculation in Total Sheet Required Standby Time in Hours 24 Hours Standby Load Current 0.22567 Amps 24 IntelliKnight 6808 Battery Calculation Note 1: You are fully responsible for verifying these calculations. Page 3 5/30/2020Honeywell Internal Device Qty Total Qty Total SRL 15CD 1 x 0.000000 = 0.000000 1 x 0.043000 = 0.043000 SRL 30CD 1 x 0.000000 = 0.000000 1 x 0.063000 = 0.063000 SRL 75CD 2 x 0.000000 = 0.000000 2 x 0.107000 = 0.214000 P2RL 15CD 4 x 0.000000 = 0.000000 4 x 0.054000 = 0.216000 P2RL 30CD 2 x 0.000000 = 0.000000 2 x 0.074000 = 0.148000 P2RK 30CD 1 x 0.000000 = 0.000000 1 x 0.107000 = 0.107000 x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = 0.000000 0.791000 Device Qty Total Qty Total P2RK 110CD 4 x 0.000000 = 0.000000 4 x 0.212000 = 0.848000 x 0.000000 = x 0.212000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = 0.000000 0.848000 Device Qty Total Qty Total 125LEDFR24DB BEACON 1 x 0.000000 = 0.000000 1 x 0.060000 = 0.060000 x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = 0.000000 0.060000 Device Qty Total Qty Total P2RL 15CD 1 x 0.000000 = 0.000000 1 x 0.000000 = 0.000000 P2RK 110CD 4 x 0.000000 = 0.000000 4 x 0.212000 = 0.848000 x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = x 0.000000 = 0.000000 0.848000Total Standby Load Total Alarm Load Non-Alarm Draw Alarm Draw Total Standby Load Total Alarm Load NAC 4 Non-Alarm Draw Alarm Draw NAC 2 Non-Alarm Draw Alarm Draw Total Standby Load Total Alarm Load NAC 3 IntelliKnight 6808 Circuit Detail NAC 1 Non-Alarm Draw Alarm Draw Total Standby Load Total Alarm Load Page 4 5/30/2020Honeywell Internal Starting Voltage Minimum Voltage @ EOL Voltage Drop Warning % Wire Type Actual Resistance Percent Drop Circuit Name AWG Ohms Percent NAC 1 #14 Solid 1.54 5.95% NAC 2 #14 Solid 1.23 5.10% NAC 3 #14 Solid 0.43 0.13% NAC 4 #14 Solid 1.47 6.13% Note: All Resistance values are taken from Table 8 Conductor Properties of the NFPA 70 National Electrical Code. All values are for Direct Current Resistance at 75°C (167°F). #16 Stranded 4.99 #18 Solid 7.77 #18 Stranded 7.95 #14 Solid 3.07 #14 Stranded 3.14 #16 Solid 4.89 #10 Stranded 1.24 #12 Solid 1.93 #12 Stranded 1.98 Resistance Table Wire Type Resitance AWG Ohms/1000 ft. #10 Solid 1.21 0.060 3.07 70 20.37 0.848 3.07 240 19.15 0.791 3.07 250 19.19 0.848 3.07 200 19.36 Current Draw Resistance Length Voltage @ EOL Amps Ohms/1000 ft. Feet (One Way)Volts IntelliKnight 6808 EOL Voltage Drop 20.4 Volts 16 Volts 10.00% Page 5 5/30/2020Honeywell Internal 24 20200409_ES_HAL 5 1.2 Date: 5/26/2020 10 Panel ID: Model: 3.0 Amps Location: Volts: 24 VDC 6.0 Amps Wire AWG Ohms Per Length(ft) Actual Volts @ Standby Alarm & Type 1000 Ft. One-Way Ohms EOL 5496 1 0.040 0.160 NAC #1 ####0.000 0.000 #14 Solid 2.52 300 1.51 20.40 0.00% NAC #2 ####0.000 0.000 #14 Solid 2.52 270 1.36 20.40 0.00% NAC #3 ####0.000 0.000 #14 Solid 2.52 330 1.66 20.40 0.00% NAC #4 ####0.000 0.000 #14 Solid 2.52 0.00 20.40 0.00% 0.040 0.160 24 0.083 (5 Mins) 0.960 0.013 %DropCurrent Draw 5496 Pwr Module Part.# Description Qty 1.20Multiply By The Derating Factor Notification Appl Circuit Standby Time In Hours Notification Appl Circuit Notification Appl Circuit Notification Appl Circuit Voltage Drop Warning Threshold % : Standby Hours: Alarm Mins: Derating Factor: Project Name: HALSTEAD SALEM STATION Project ID: Prepared By: ALARM DESIGN SPECIALISTS Command Shortcuts Total Standby AH Required 5496 Power Expander Calculations Max NAC Current: Max Panel Current: 1ST FLR ELECTRICAL Version 02.24.09 RPS-1 5496 Power Expander Total Alarm Current (Amps)Total Standby Current (Amps) Alarm Time In Minutes / 60 Minimum Battery AmpHours Required 1.17 0.97Total Combined AH Required Total Alarm AH Required Global Project Values: Configure Circuits Print Page 24 20200409_ES_HAL 5 1.2 Date: 5/26/2020 11 Panel ID: Model: 3.0 Amps Location: Volts: 24 VDC 6.0 Amps Wire AWG Ohms Per Length(ft) Actual Volts @ Standby Alarm & Type 1000 Ft. One-Way Ohms EOL 5496 1 0.040 0.160 NAC #1 ####0.000 0.518 #14 Solid 2.52 420 2.12 19.30 5.38% NAC #2 ####0.000 0.972 #14 Solid 2.52 270 1.36 19.08 6.48% NAC #3 ####0.000 1.266 #14 Solid 2.52 330 1.66 18.29 10.32% NAC #4 ####0.000 0.000 #14 Solid 2.52 0.00 20.40 0.00% 0.040 2.916 24 0.083 (5 Mins) 0.960 0.243 Total Alarm Current (Amps)Total Standby Current (Amps) Alarm Time In Minutes / 60 Minimum Battery AmpHours Required 1.44 1.20Total Combined AH Required Total Alarm AH Required Command Shortcuts Total Standby AH Required 5496 Power Expander Calculations Max NAC Current: Max Panel Current: 2ND FLR ELECTRICAL Version 02.24.09 RPS-2 5496 Power Expander Voltage Drop Warning Threshold % : Standby Hours: Alarm Mins: Derating Factor: Project Name: HALSTEAD SALEM STATION Project ID: Prepared By: ALARM DESIGN SPECIALISTS 1.20Multiply By The Derating Factor Notification Appl Circuit Standby Time In Hours Notification Appl Circuit Notification Appl Circuit Notification Appl Circuit %DropCurrent Draw 5496 Pwr Module Part.# Description Qty Global Project Values: Configure Circuits Print Page 24 20200409_ES_HAL 5 1.2 Date:5/26/2020 11 Panel ID: Model:3.0 Amps Location: Volts:24 VDC 6.0 Amps Wire AWG Ohms Per Length(ft)Actual Volts @ Standby Alarm & Type 1000 Ft.One-Way Ohms EOL 5496 1 0.040 0.160 NAC #1 ####0.000 0.471 #14 Solid 2.52 340 1.71 19.59 3.96% NAC #2 ####0.000 0.972 #14 Solid 2.52 270 1.36 19.08 6.48% NAC #3 ####0.000 1.266 #14 Solid 2.52 330 1.66 18.29 10.32% NAC #4 ####0.000 0.079 #14 Solid 2.52 80 0.40 20.37 0.16% 0.040 2.948 24 0.083 (5 Mins) 0.960 0.246 %DropCurrent Draw 5496 Pwr Module Part.#Description Qty 1.20Multiply By The Derating Factor Notification Appl Circuit Standby Time In Hours Notification Appl Circuit Notification Appl Circuit Notification Appl Circuit Voltage Drop Warning Threshold % : Standby Hours: Alarm Mins: Derating Factor: Project Name:HALSTEAD SALEM STATION Project ID: Prepared By:ALARM DESIGN SPECIALISTS Command Shortcuts Total Standby AH Required 5496 Power Expander Calculations Max NAC Current: Max Panel Current: 3RD FLR ELECTRICAL Version 02.24.09 RPS-3 5496 Power Expander Total Alarm Current (Amps)Total Standby Current (Amps) Alarm Time In Minutes / 60 Minimum Battery AmpHours Required 1.45 1.21Total Combined AH Required Total Alarm AH Required Global Project Values: Configure Circuits Print Page Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent N1•001 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 9.6892' 20.3579v 0.0421v 0.21 % N1•002 P2RK 2‐Wire Horn/Strobe outdoor red 30cd 0.1160A 2.4079' 20.3481v 0.0519v 0.25 % N1•003 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 8.7376' 20.3178v 0.0822v 0.40 % N1•004 P2RL 2‐Wire, Horn Strobe, Red 30cd 0.0740A 12.1467' 20.2790v 0.1210v 0.59 % N1•005 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 54.8549' 20.1248v 0.2752v 1.35 % N1•006 SRL Strobe, Red 15cd 0.0430A 10.6451' 20.0978v 0.3022v 1.48 % N1•007 SRL Strobe, Red 75cd 0.1070A 17.4497' 20.0575v 0.3425v 1.68 % N1•008 SRL Strobe, Red 30cd 0.0630A 24.1602' 20.0149v 0.3851v 1.89 % N1•009 SRL Strobe, Red 75cd 0.1070A 27.6342' 19.9751v 0.4249v 2.08 % N1•010 P2RL 2‐Wire, Horn Strobe, Red 75cd 0.1190A 16.4573' 19.9605v 0.4395v 2.15 % N1•011 EOL P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 55.9796' 19.9449v 0.4551v 2.23 % Project: 20200409_ES_HALSTEAD‐2 Panel FACP Point‐to‐Point Voltage Drop Calculation for Circuit N1 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.8450A Total Distance: 240.1624' Voltage Drop: 0.4551v End Of Line Voltage: 19.9449v Percent Drop: 2.23 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 1 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent N2•001 P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2210A 50.6079' 20.1771v 0.2229v 1.09 % FACP•N2•002P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 59.1407' 19.9837v 0.4163v 2.04 % FACP•N2•003P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 54.0803' 19.8659v 0.5341v 2.62 % FACP•N2•004P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 33.1126' 19.8298v 0.5702v 2.80 % Project: 20200409_ES_HALSTEAD‐2 Panel FACP Point‐to‐Point Voltage Drop Calculation for Circuit N2 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.8570A Total Distance: 196.9416' Voltage Drop: 0.5702v End Of Line Voltage: 19.8298v Percent Drop: 2.80 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 2 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent N3•001 EOL 125LEDFR24DB BEACON, FLASHING LED, RED 750cd 0.7800A 60.0296' 20.1593v 0.2407v 1.18 % Project: 20200409_ES_HALSTEAD‐2 Panel FACP Point‐to‐Point Voltage Drop Calculation for Circuit N3 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.7800A Total Distance: 60.0296' Voltage Drop: 0.2407v End Of Line Voltage: 20.1593v Percent Drop: 1.18 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 3 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent FACP•N4•001P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 66.1776' 20.0932v 0.3068v 1.50 % FACP•N4•002P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 52.2542' 19.9079v 0.4921v 2.41 % FACP•N4•003P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 60.9889' 19.7580v 0.6420v 3.15 % FACP•N4•004P2RK 2‐Wire Horn/Strobe outdoor red 110cd 0.2120A 33.1126' 19.7127v 0.6873v 3.37 % N4•005 EOL P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 24.0919' 19.7061v 0.6939v 3.40 % Project: 20200409_ES_HALSTEAD‐2 Panel FACP Point‐to‐Point Voltage Drop Calculation for Circuit N4 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.9020A Total Distance: 236.6252' Voltage Drop: 0.6939v End Of Line Voltage: 19.7061v Percent Drop: 3.40 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 4 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent N1•001 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 35.1182' 20.3325v 0.0675v 0.33 % N1•002 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 48.8506' 20.2548v 0.1452v 0.71 % N1•003 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 76.7935' 20.1582v 0.2418v 1.19 % N1•004 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 77.7744' 20.0861v 0.3139v 1.54 % N1•005 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 34.2695' 20.0656v 0.3344v 1.64 % N1•006 EOL 4SRL Strobe, Red 15cd 0.0430A 26.4351' 20.0587v 0.3413v 1.67 % Project: 20200409_ES_HALSTEAD‐2 Panel 1 Point‐to‐Point Voltage Drop Calculation for Circuit N1 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.3130A Total Distance: 299.2413' Voltage Drop: 0.3413v End Of Line Voltage: 20.0587v Percent Drop: 1.67 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 5 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 1•N2•001 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 44.0110' 20.1801v 0.2199v 1.08 % 1•N2•002 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 35.3343' 20.0232v 0.3768v 1.85 % 1•N2•003 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 41.2786' 19.8628v 0.5372v 2.63 % 1•N2•004 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9241' 19.8597v 0.5403v 2.65 % 1•N2•005 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.0826' 19.7096v 0.6904v 3.38 % 1•N2•006 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9241' 19.7076v 0.6924v 3.39 % 1•N2•007 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.1243' 19.6174v 0.7826v 3.84 % 1•N2•008 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 28.6000' 19.5857v 0.8143v 3.99 % 1•N2•009 EO HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.8801' 19.5852v 0.8148v 3.99 % Project: 20200409_ES_HALSTEAD‐2 Panel 1 Point‐to‐Point Voltage Drop Calculation for Circuit N2 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.9720A Total Distance: 260.1590' Voltage Drop: 0.8148v End Of Line Voltage: 19.5852v Percent Drop: 3.99 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 6 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 1•N3•001 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 56.1601' 19.9635v 0.4365v 2.14 % 1•N3•002 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 27.6265' 19.7670v 0.6330v 3.10 % 1•N3•003 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 40.5751' 19.5054v 0.8946v 4.39 % 1•N3•004 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9040' 19.5002v 0.8998v 4.41 % 1•N3•005 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 40.8391' 19.2911v 1.1089v 5.44 % 1•N3•006 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.8801' 19.2872v 1.1128v 5.46 % 1•N3•007 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.1482' 19.0817v 1.3183v 6.46 % 1•N3•008 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 27.5022' 18.9956v 1.4044v 6.88 % N3•009 SRL Strobe, Red 15cd 0.0430A 36.3649' 18.9058v 1.4942v 7.32 % N3•010 SRL Strobe, Red 75cd 0.1070A 23.0256' 18.8551v 1.5449v 7.57 % 1•N3•011 EO P2RL‐LF 2‐Wire, Horn Strobe, Red 185cd 0.2520A 12.6969' 18.8354v 1.5646v 7.67 % Project: 20200409_ES_HALSTEAD‐2 Panel 1 Point‐to‐Point Voltage Drop Calculation for Circuit N3 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 1.2660A Total Distance: 320.7228' Voltage Drop: 1.5646v End Of Line Voltage: 18.8354v Percent Drop: 7.67 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 7 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent N1•001 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 35.1182' 20.2890v 0.1110v 0.54 % N1•002 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 48.8506' 20.1507v 0.2493v 1.22 % N1•003 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 76.7935' 19.9588v 0.4412v 2.16 % N1•004 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 77.7744' 19.7902v 0.6098v 2.99 % N1•005 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0540A 34.2695' 19.7273v 0.6727v 3.30 % N1•006 SRL Strobe, Red 15cd 0.0430A 26.3911' 19.6876v 0.7124v 3.49 % N1•007 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 14.7844' 19.6693v 0.7307v 3.58 % N1•008 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 32.0164' 19.6400v 0.7600v 3.73 % N1•009 SRL Strobe, Red 15cd 0.0430A 23.3473' 19.6262v 0.7738v 3.79 % N1•010 EOL 4P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 43.8322' 19.6119v 0.7881v 3.86 % Project: 20200409_ES_HALSTEAD‐2 Panel 2 Point‐to‐Point Voltage Drop Calculation for Circuit N1 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.5150A Total Distance: 413.1777' Voltage Drop: 0.7881v End Of Line Voltage: 19.6119v Percent Drop: 3.86 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 8 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 2•N2•001 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 44.0110' 20.1373v 0.2627v 1.29 % 2•N2•002 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 35.3343' 19.9499v 0.4501v 2.21 % 2•N2•003 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 41.2786' 19.7583v 0.6417v 3.15 % 2•N2•004 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9241' 19.7546v 0.6454v 3.16 % 2•N2•005 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.0826' 19.5753v 0.8247v 4.04 % 2•N2•006 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9241' 19.5728v 0.8272v 4.05 % 2•N2•007 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.1243' 19.4652v 0.9348v 4.58 % 2•N2•008 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 28.6000' 19.4272v 0.9728v 4.77 % 2•N2•009 EO HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.8801' 19.4267v 0.9733v 4.77 % Project: 20200409_ES_HALSTEAD‐2 Panel 2 Point‐to‐Point Voltage Drop Calculation for Circuit N2 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.9720A Total Distance: 260.1590' Voltage Drop: 0.9733v End Of Line Voltage: 19.4267v Percent Drop: 4.77 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 9 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 2•N3•001 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 56.1601' 20.0346v 0.3654v 1.79 % 2•N3•002 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 27.6265' 19.8701v 0.5299v 2.60 % 2•N3•003 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 40.5751' 19.6511v 0.7489v 3.67 % 2•N3•004 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9040' 19.6468v 0.7532v 3.69 % 2•N3•005 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 40.8391' 19.4717v 0.9283v 4.55 % 2•N3•006 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.8801' 19.4684v 0.9316v 4.57 % 2•N3•007 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.1482' 19.2964v 1.1036v 5.41 % 2•N3•008 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 27.5022' 19.2243v 1.1757v 5.76 % N3•009 SRL Strobe, Red 15cd 0.0430A 36.3649' 19.1492v 1.2508v 6.13 % N3•010 SRL Strobe, Red 75cd 0.1070A 23.0256' 19.1067v 1.2933v 6.34 % 2•N3•011 EO P2RL‐LF 2‐Wire, Horn Strobe, Red 185cd 0.2520A 12.6969' 19.0902v 1.3098v 6.42 % Project: 20200409_ES_HALSTEAD‐2 Panel 2 Point‐to‐Point Voltage Drop Calculation for Circuit N3 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 1.2660A Total Distance: 320.7228' Voltage Drop: 1.3098v End Of Line Voltage: 19.0902v Percent Drop: 6.42 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 10 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent N1•001 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 35.1182' 20.2995v 0.1005v 0.49 % N1•002 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 48.8506' 20.1756v 0.2244v 1.10 % N1•003 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 76.7935' 20.0059v 0.3941v 1.93 % N1•004 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 77.7744' 19.8593v 0.5407v 2.65 % 3•N1•005 P2RK 2‐Wire Horn/Strobe outdoor red 15cd 0.0790A 45.8118' 19.7878v 0.6122v 3.00 % N1•006 P2RL 2‐Wire, Horn Strobe, Red 15cd 0.0530A 14.3288' 19.7725v 0.6275v 3.08 % N1•007 SRL Strobe, Red 15cd 0.0430A 26.3911' 19.7527v 0.6473v 3.17 % 3•N1•008 EO P2RK 2‐Wire Horn/Strobe outdoor red 15cd 0.0790A 6.2708' 19.7496v 0.6504v 3.19 % Project: 20200409_ES_HALSTEAD‐2 Panel 3 Point‐to‐Point Voltage Drop Calculation for Circuit N1 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.4660A Total Distance: 331.3392' Voltage Drop: 0.6504v End Of Line Voltage: 19.7496v Percent Drop: 3.19 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 11 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 3•N2•001 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 44.0110' 20.1373v 0.2627v 1.29 % 3•N2•002 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 35.3343' 19.9499v 0.4501v 2.21 % 3•N2•003 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 41.2786' 19.7583v 0.6417v 3.15 % 3•N2•004 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9241' 19.7546v 0.6454v 3.16 % 3•N2•005 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.0826' 19.5753v 0.8247v 4.04 % 3•N2•006 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9241' 19.5728v 0.8272v 4.05 % 3•N2•007 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.1243' 19.4652v 0.9348v 4.58 % 3•N2•008 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 28.6000' 19.4272v 0.9728v 4.77 % 3•N2•009 EO HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.8801' 19.4267v 0.9733v 4.77 % Project: 20200409_ES_HALSTEAD‐2 Panel 3 Point‐to‐Point Voltage Drop Calculation for Circuit N2 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.9720A Total Distance: 260.1590' Voltage Drop: 0.9733v End Of Line Voltage: 19.4267v Percent Drop: 4.77 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 12 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 3•N3•001 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 56.1601' 19.9514v 0.4486v 2.20 % 3•N3•002 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 27.6265' 19.7490v 0.6510v 3.19 % 3•N3•003 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 40.5751' 19.4787v 0.9213v 4.52 % 3•N3•004 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.9040' 19.4733v 0.9267v 4.54 % 3•N3•005 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 40.8391' 19.2554v 1.1446v 5.61 % 3•N3•006 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 0.8801' 19.2513v 1.1487v 5.63 % 3•N3•007 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 54.1482' 19.0342v 1.3658v 6.70 % 3•N3•008 HRL‐LF LF Sounder Strobe, Wall, Red 0.1080A 27.5022' 18.9421v 1.4579v 7.15 % N3•009 SRL Strobe, Red 15cd 0.0430A 36.3649' 18.8446v 1.5554v 7.62 % 3•N3•010 SRL Strobe, Red 75cd 0.1420A 23.0256' 18.7889v 1.6111v 7.90 % 3•N3•011 EO P2RL‐LF 2‐Wire, Horn Strobe, Red 185cd 0.2520A 12.6969' 18.7692v 1.6308v 7.99 % Project: 20200409_ES_HALSTEAD‐2 Panel 3 Point‐to‐Point Voltage Drop Calculation for Circuit N3 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 1.3010A Total Distance: 320.7228' Voltage Drop: 1.6308v End Of Line Voltage: 18.7692v Percent Drop: 7.99 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 13 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 Device Label Part No. Description Device Current Dist. From Previous Voltage At Device Voltage Drop From Source Voltage Drop Percent 3•N4•001 EO P2RK 2‐Wire Horn/Strobe outdoor red 15cd 0.0790A 77.5975' 20.3624v 0.0376v 0.18 % Project: 20200409_ES_HALSTEAD‐2 Panel 3 Point‐to‐Point Voltage Drop Calculation for Circuit N4 Starting Calculation Voltage: 20.4000v Minimum Operational Voltage: 16.0000v Total Circuit Current: 0.0790A Total Distance: 77.5975' Voltage Drop: 0.0376v End Of Line Voltage: 20.3624v Percent Drop: 0.18 % Wire GA=#14 AWG Distance measured using drawn segment lengths with 10.00 % additional length calculated 14 of 14 125 SAVANNAH AVENUE GRANDY, NC 27939 PHONE: 252‐506‐2086 FAX: 252‐597‐8082 SECTION IV QUALIFICATIONS SECTION V SHOP DRAWINGS FIRE ALARM SYSTEM NOTES1.IT IS THE INTENTION OF THESE DRAWINGS TO COVER ALL WORK ANDMATERIAL FOR A FIRE ALARM SYSTEM MODIFICATION. ALL EQUIPMENT,TRIM HARDWARE AND/OR DEVICES USUALLY UTILIZED IN THE CLASSOF WORK SHALL BE SHOWN ON PLANS AND SHALL BE FURNISHED ANDINSTALLED AS PART OF HIS TOTAL WORK.2.THE FIRE ALARM SYSTEM MODIFICATION IN ITS ENTIRETY SHALL BE INCOMPLIANCE WITH ALL APPLICABLE FIRE AND ELECTRICAL CODESAND COMPLY WITH THE REQUIREMENTS OF LOCAL AUTHORITY HAVINGJURISDICTION. THESE CODES INCLUDE, BUT ARE NOT LIMITED TO THEFOLLOWING:A.2015 INTERNATIONAL BUILDING CODE AS ADOPTED BYMASSACHUSETTS WITH ADMENDMENTS3.VERIFY ALL CONDITIONS PRIOR TO BEGINNING WORK OR ORDERINGEQUIPMENT.A.CORRDINATE WITH ELECTRICAL CONTRACTOR FOR ALL REQUIREDCONDUITS SO AS TO MEET SIZE AND PROPER LOCATION.B.CORRDINATE WITH ELEVATOR CONTRACTOR THE LOCATION OFTHE ELEVATOR CONTROLLER FOR THE PURPOSE OF LOCATINGCONTROL RELAYS CORRESPONDING WITH PRIMARY RECALL,ALTERNATE RECALL, FIRE HAT, SHUNT TRIP, AND SHAFT DAMPER.C.CORRDINATE WITH FIRE SUPPRESSION CONTRACTOR LOCATIONSOF ALL WATER FLOW SWITCHES, VALVE TAMPER SWITCHES,PRESSURE SWITCHES, FIRE PUMP CONROL PANEL, ETC. FORPURPOSES OF MONITORING OR CONTROL. DETERMINE THELOCATIONS OF THE SPRINKLER HEADS IN THE ELEVATOR PIT ANDTOP OF SHAFT FOR LOCATION OF HEAT DETECTORS.D.CORRDINATE WITH MECHANICAL CONTRACTOR LOCATIONS ANDVOLTAGE OF ALL DAMPERS AND DUCT SMOKES FOR THEPURPOSE OF MONITORING OR CONTROL. DETERMINE FOR ALLDAMPERS THE NORMAL STATE AND THE POSITION WHEN INALARM.4.THE SYSTEM SHALL INCLUDE BUT NOT LIMITED TO ALL CONTROL ANDCOMMUNICATION EQUIPMENT, POWER SUPPLY (INCLUDING REMOTEPOWER SUPPLIES), SIGNAL INITIATING DEVICES, AND AUDIBLE ANDVISUAL ALARM INDICATING APPLIANCES.5.ALL EQUIPMENT SHALL BE LISTED AS POWER LIMITED BYUNDERWRITERS LABORATORIES, INC., APPROVED BY FACTORYMUTUAL OR AS ACCEPTED BY THE AUTHORITY HAVING JURISDICTION.6.ACCESSORY COMPONENTS AS REQUIRED SHALL BE CATALOGED BYMANUFACTURER AND U.L. LISTED TO OPERATE WITH THEMANUFACTURER'S CONTROL PANEL.7.SMOKE DETECTORS AND HEAT DETECTORS, HVAC SMOKEDETECTORS, PULL STATIONS, HORNS AND STROBES, FACP WITH OFFSITE IP COMMUNICATIONS OR DIALER AND ANNUNCIATION PANEL ATMAIN ENTRANCE ARE TO BE DESIGNED AND INSTALLED BY LICENSEDFIRE ALARM CONTRACTOR IN COMPLIANCE WITH NFPA 72 (NATIONALFIRE ALARM CODE).8.BATTERIES SHALL BE 12 VOLT, GELL-CELL TYPE. BATTERIES SHALLHAVE SUFFICIENT CAPACITY TO POWER THE FIRE ALARM SYSTEM FORNOT LESS THAN TWENTY- FOUR HOURS PLUS 5 MINUTES OF ALARMUPON A NORMAL AC POWER FAILURE. THE BATTERIES ARE TO BECOMPLETELY MAINTENANCE FREE. NO LIQUIDS ARE REQUIRED. FLUIDLEVEL CHECKS REFILLING, SPILLS AND LEAKAGE SHALL NOT BEREQUIRED.9.THE INSTALLER SHALL COORDINATE THE INSTALLATION OF THE FIREALARM EQUIPMENT WITH THE MANUFACTURER OR HIS AUTHORIZEDDISTRIBUTOR.10.ALL CONDUCTORS AND WIRING SHALL BE INSTALLED IN ACCORDANCETO THE MANUFACTURER'S RECOMMENDATIONS. COVERS OFJUNCTION BOXES SERVING THE FIRE ALARM SYSTEM SHALL BEPAINTED RED. ALL EXPOSED WIRING SHALL BE IN CONDUIT.11.THIS PROJECT IS NOT AN OPEN PLENUM DESIGN. FPL CABLE ORHIGHER IS ACCEPTABLE.12.IT SHALL BE THE INSTALLERS RESPONSIBILITY TO COORDINATE WITHSUPPLIER, REGARDING THE CORRECT WIRING PROCEDURES BEFOREINSTALLING ANY CONDUITS OR CONDUCTORS.13.THE INTENT OF THE CIRCUITRY PATHS INDICATED ON THE SUBMITTALDRAWINGS ARE TO INDICATE THE REQUIRED WIRING AND/OR CABLINGTYPES AND TO INDICATE WHICH DEVICES ARE CONNECTED THEDIFFERENT CIRCUIT TYPES. IT IS THE RESPONSIBILITY OF THEELECTRICAL CONTRACTOR AND/OR INSTALLING CONTRACTOR TODETERMINE THE EXACT ROUTING BASED ON THE FOLLOWINGCRITERIA: FIELD CONDITIONS, DESIRED ROUTING, VOLTAGE DROPLIMITATIONS, ETC. AND TO GENERATE AS-BUILT DRAWINGS INDICATINGTHE EXACT ROUTING OF THESE CIRCUITS.14.FIELD VERIFY BACK BOX REQUIREMENTS AND MOUNTING DETAILS ONDEVICE DATA SHEETS.15.ALL IDC AND NAC SHALL BE WIRED AS A "CLASS B" PERFORMANCECIRCUIT.16.THE 120VAC CIRCUIT BREAKER SHALL BE CLEARLY LABELED, THEHANDLE PAINTED RED AND A LOCKING DEVICE SHALL BE INSTALLED INTHE "ON" POSITION.NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2SBUSSBUSSBUSSBUSSBUSSBUSSBUSCATCATCATCATCATCATCATCAT120VAC120VAC120VAC120VAC120VAC120VACNAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1IDCIDCIDCIDCIDCIDCIDCIDC14/2 FPLR14/2 FPLR14/2 FPLR14/2 FPLR18/2 FPLR18/2 FPLR18/4 FPLRCAT 5e CMR#12 THHNSLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC218/2 FPLRFIRE ALARM CABLE LEGEND:RTSRTSRTSRTSRTSRTSRTSRTS18/4 FPLRALARMPULLMANUALPULLTYPICAL DEVICE MOUNTING HEIGHTSFIRELIFT&FIRE ALARMANNUNICATORPANEL(FAAP)FIRE ALARMCONTROL PANEL(FACP)FIRE ALARMDOCUMENT CABINET(FADC)FIRE ALARMDOCUMENTSRecords / Manuals / Programs42"50"72"72"NOTIFICATIONAPPLIANCECIRCUIT PANEL(NACP)50"80" MINFINISHED FLOOR96" MAXAUDIO/VISUALAPPLIANCES12" MAX1'SMOKE DETECTOR MOUNTED ON CEILING OR WALLACCORDING TO 17.6.3.1.3.14" SQUARE BOXCEILINGSEE NOTE**** IN SLEEPING AREAS: 110CD IS REQUIRED IF FROM TOPOF LENS TO THE CEILING IS AT LEAST 24", IF LESS THAN24" 177CD IS REQUIRED ACCORDING TO 18.5.5.7.260" MAXDOOROPENING72" MAXFIRE ALARMTERMINALCABINET(FATC)SSPSSPDATE:SCALE:FILE NAME:REVISIONS:1/213/41/40DRAWING PREPARED BY:EARL T. HALL, SETNICET CERT. NO. 118619FIRE ALARM SYS - LVL IVCERT. EXPIRES: 01/01/2022DRAWN BY:CHECKED BY:FA-1.0HALSTEAD SALEM STATION - BUILDING 2 FIRE ALARM SYSTEM - GENERAL NOTES & LEGEND 72 FLINT STREET, 67-71 MASON STREET SALEM, MA 0197005/20/2020N.T.S.20200409_ES_HALSTEAD-2ETHSM40 LOWELL ROAD, UNIT #1 SALEM, NEW HAMPSHIRE 03079 PHONE: (603) 894-4500 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC1 NAC1 NAC1 NAC1 NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••120 VOLTS AC:60HzDEDICATED CIRCUITRPS-1120 VOLTS AC:60HzDEDICATED CIRCUITFACP••••••••••••••••••••••••••••SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC1 NAC1 NAC1 NAC1 SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2120 VOLTS AC:60HzDEDICATED CIRCUITRPS-2NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 NAC3 SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC2 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 NAC1 SLC2 SLC2 SLC2 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 RTS RTS RTS RTS RTS RTS IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDCIDCIDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDCIDCIDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDCIDCIDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDCIDCIDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDCIDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDCIDC1ST FLOOR2ND FLOORIDC IDC IDC IDC IDC IDC IDCNAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3IDC IDC IDC IDC IDC IDC IDC IDC IDC IDCIDC120 VOLTS AC:60HzDEDICATED CIRCUITRPS-3NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4 NAC4ROOF SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2 SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 SLC1 NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3PARKING LEVELSLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT•SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS SBUS NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC33RD FLOORSSP120VAC120VAC120VAC120VACCATCATCATCATCAT120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VACIO1 IO1 IO1 IO1 IO1IO1IO1IO1IO1IO1IO1120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VAC120VACSSP•••••••••••••••••••••••••••••••••••••••••••••••••••••SSPSSPDATE:SCALE:FILE NAME:REVISIONS:1/213/41/40DRAWING PREPARED BY:EARL T. HALL, SETNICET CERT. NO. 118619FIRE ALARM SYS - LVL IVCERT. EXPIRES: 01/01/2022DRAWN BY:CHECKED BY:FA-2.0HALSTEAD SALEM STATION - BUILDING 2 FIRE ALARM SYSTEM - RISER 72 FLINT STREET, 67-71 MASON STREET SALEM, MA 0197005/20/2020N.T.S.20200409_ES_HALSTEAD-2ETHSM40 LOWELL ROAD, UNIT #1 SALEM, NEW HAMPSHIRE 03079 PHONE: (603) 894-4500 VESTIBULEBUSINESSLOUNGEUPCROSS FITAREALEASINGFITNESSCORRIDORSTRENGTHAREAROCK/PEG WALLSPORTSLOUNGEUPJAN.GAMELOUNGEUP13GAS SPRINKLER WATERUPCOVEREDPATIOPATIO/ ENTRANCE123456789101112STORG.ELECTRICVEHICLECHARGINGSTATIONUNEXCAVATEDSTAIR-21/A5.01UPUPELEVATORMACHINEROOMSTAIR-11/A5.00ENTRY/ ELEV.LOBBYRMAILELECTRICAL ROOMELEV.2/A5.10262524232221201918171615UPPACKAGEROOMRESTROOMVIRTUAL SPORTSSIMULATORRESOURCESTRUCT BRACEMANAGERSOFFICEPARKING LEVEL PLANMAIL••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••IDCSLC1SLC1•••••••SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4SLC1SLC1SLC1SLC1SLC1 SLC1 SLC1•SLC1SLC1 SLC1 SLC1SLC1••SLC1SLC1•SLC1 SLC1 SLC1 SLC1SLC1SLC1SLC1SLC1SLC1SLC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1 NAC1•NAC4 NAC4 NAC4NAC2NAC2NAC2NAC2NAC2•SLC1TO 1ST FLR ELECTRICAL CLOSETSBUSSBUSTO 1ST FLR RPS-1RTSRTSRTSRTSRTSRTSRTSRTSRTSRTSRTSTO BEAM DETECTORTO BEAM DETECTOR•NAC3NAC3NAC3NAC3NAC3NAC3NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4DATE:SCALE:FILE NAME:REVISIONS:1/213/41/40DRAWING PREPARED BY:EARL T. HALL, SETNICET CERT. NO. 118619FIRE ALARM SYS - LVL IVCERT. EXPIRES: 01/01/2022DRAWN BY:CHECKED BY:FA-3.0HALSTEAD SALEM STATION - BUILDING 2 FIRE ALARM SYSTEM - PARKING LEVEL 72 FLINT STREET, 67-71 MASON STREET SALEM, MA 0197005/20/20201/8" = 1'20200409_ES_HALSTEAD-2ETHSM40 LOWELL ROAD, UNIT #1 SALEM, NEW HAMPSHIRE 03079 PHONE: (603) 894-4500 UNIT 2101A2C ASASAA CUNIT 2102A2SAAA CUNIT 2103A1UNIT 2104A1C ASSAAA CUNIT 2105A1UNIT 2106A1C ASS AUNIT 2107C AB3S ASTAIR-22/A5.01TRASHROOMS ACORRIDOR 115 SC AUNIT 2108B7DNUPL FUTILITYA CSTAIR-12/A5.00C AS AELEV.2/A5.10F LS AF LUNIT 2114A4ASA CUNIT 2113A1ASA CUNIT 2112A1UNIT 2111A1C AASA SUNIT 2110B4A SS AUNIT 2109B3C AS AEPDM ROOFINGOPEN TO COMMERCIAL SPACE BELOWHWW/DHPCORRIDOR 116 •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1SLC1•IDCSLC1 NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC3NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1 NAC1 NAC1 NAC1 NAC1NAC3 NAC3 NAC3NAC3 NAC3 NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC1 NAC1 NAC1 NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3 NAC3 NAC3NAC2NAC2NAC2NAC2NAC2NAC2NAC2 NAC3NAC3NAC3NAC1NAC1SLC1FROM PARKING LVL•SLC1SLC1SLC1SLC1SBUSSBUSSBUSFROM FACPTO 2ND FLR RPS-2FIRST FLOOR PLANSLC2TO 2ND FLR DATE:SCALE:FILE NAME:REVISIONS:1/213/41/40DRAWING PREPARED BY:EARL T. HALL, SETNICET CERT. NO. 118619FIRE ALARM SYS - LVL IVCERT. EXPIRES: 01/01/2022DRAWN BY:CHECKED BY:FA-3.1HALSTEAD SALEM STATION - BUILDING 2 FIRE ALARM SYSTEM - FIRST FLOOR PLAN 72 FLINT STREET, 67-71 MASON STREET SALEM, MA 0197005/20/20201/8" = 1'20200409_ES_HALSTEAD-2ETHSM40 LOWELL ROAD, UNIT #1 SALEM, NEW HAMPSHIRE 03079 PHONE: (603) 894-4500 OPEN TO BELOWFITNESSAREAOPEN TO BELOWRESTROOMROCK/PEG WALLROOF BELOWDNSTAIR-1C AS ADNUPL FCORRIDOR 215C AUNIT 2208B7S AC AUNIT 2201A2C ASASAA CUNIT 2202A2SAA CUNIT 2203A1UNIT 2204A1C ASASAA CUNIT 2205A1UNIT 2206A1C ASAS AUNIT 2207B3S AUPSTAIR-2DNTRASHROOMELEV.F LS AF LUNIT 2214A4ASA CUNIT 2213A1ASUNIT 2212A1A CUNIT 2211A1C AASA SUNIT 2210B4A CA SS AUNIT 2209B3C AS AHWW/DHPCORRIDOR 216 DN••••••••••••••••••••••••••••••••••••••••••••••••••••SLC1SLC1SLC1SLC1SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2•IDCSLC2 NAC3NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1 NAC1 NAC1 NAC1 NAC1NAC3 NAC3 NAC3NAC3 NAC3 NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC1 NAC1 NAC1 NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3 NAC3 NAC3NAC2NAC2NAC2NAC2 NAC3NAC3NAC3NAC1NAC1••••••••••••••NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2••••••••SLC2SLC2SLC2 SLC2SLC2SLC2 SLC2 SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2 SLC2 SLC2SLC2SLC2SLC2SLC2FROM 1ST FLR FACPSLC2TO 3RD FLR SLC2SLC2SLC2SLC2NAC1NAC1 NAC1NAC1NAC1NAC1NAC1 NAC1NAC1NAC1 NAC1STOR.•TO REMOTE TEST SWREMOTE TEST SWRTSSECOND FLOOR PLANDATE:SCALE:FILE NAME:REVISIONS:1/213/41/40DRAWING PREPARED BY:EARL T. HALL, SETNICET CERT. NO. 118619FIRE ALARM SYS - LVL IVCERT. EXPIRES: 01/01/2022DRAWN BY:CHECKED BY:FA-3.2HALSTEAD SALEM STATION - BUILDING 2 FIRE ALARM SYSTEM - SECOND FLOOR PLAN 72 FLINT STREET, 67-71 MASON STREET SALEM, MA 0197005/20/20201/8" = 1'20200409_ES_HALSTEAD-2ETHSM40 LOWELL ROAD, UNIT #1 SALEM, NEW HAMPSHIRE 03079 PHONE: (603) 894-4500 SYNTH. TURFSURFACEDECKSURFACEUNIT 2301A2C ASASAA CUNIT 2302A2SAA CUNIT 2303A1UNIT 2304A1C ASASAA CUNIT 2305A1UNIT 2306A1C ASAS AUNIT 2307B3S ATRASHROOMSTAIR-2S ADNCORRIDOR 315C AUNIT 2308B7L FLOUNGEAREAA CSTAIR-1C AS AELEV.F LS AF LUNIT 2314A4ASA CUNIT 2313A1ASUNIT 2312A1A CUNIT 2311A1C AASA SUNIT 2310B4A SS AUNIT 2309B3C AS AGRILL AREASTAIR-2PARTIAL ROOF PLANCORRIDOR 316 DN••••••••••••••••••••••••••••••••••••••••••••••SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2SLC2•IDCSLC2 NAC3NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1NAC1 NAC1 NAC1 NAC1 NAC1NAC3 NAC3 NAC3NAC3 NAC3 NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC3NAC2NAC2NAC2NAC2NAC1 NAC1 NAC1 NAC2NAC2NAC2NAC2NAC2NAC3NAC3NAC3NAC3NAC3 NAC3 NAC3NAC2NAC2NAC2NAC2 NAC3NAC3NAC3••••••••••••••NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2NAC2•SLC2FROM 2ND FLRSLC2TO ROOFSLC2SLC2SLC2SLC2•••••••••••••••NAC1NAC1NAC1NAC1NAC1NAC1NAC1 NAC1•SLC1SLC1 SLC2SLC2SLC2SLC2FROM 3RD FLR RPS-3NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4NAC4FROM 3RD FLR RPS-3STOR.••••THIRD FLOOR PLANDATE:SCALE:FILE NAME:REVISIONS:1/213/41/40DRAWING PREPARED BY:EARL T. HALL, SETNICET CERT. NO. 118619FIRE ALARM SYS - LVL IVCERT. EXPIRES: 01/01/2022DRAWN BY:CHECKED BY:FA-3.3HALSTEAD SALEM STATION - BUILDING 2 FIRE ALARM SYSTEM - THIRD FLOOR PLAN 72 FLINT STREET, 67-71 MASON STREET SALEM, MA 0197005/20/20201/8" = 1'20200409_ES_HALSTEAD-2ETHSM40 LOWELL ROAD, UNIT #1 SALEM, NEW HAMPSHIRE 03079 PHONE: (603) 894-4500